Skip to Content
MilliporeSigma
All Photos(2)

Key Documents

EHU114431

Sigma-Aldrich

MISSION® esiRNA

targeting human KRAS

Sign Into View Organizational & Contract Pricing
All Photos(2)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGGCCTGCTGAAAATGACTGAATATAAACTTGTGGTAGTTGGAGCTGGTGGCGTAGGCAAGAGTGCCTTGACGATACAGCTAATTCAGAATCATTTTGTGGACGAATATGATCCAACAATAGAGGATTCCTACAGGAAGCAAGTAGTAATTGATGGAGAAACCTGTCTCTTGGATATTCTCGACACAGCAGGTCAAGAGGAGTACAGTGCAATGAGGGACCAGTACATGAGGACTGGGGAGGGCTTTCTTTGTGTATTTGCCATAAATAATACTAAATCATTTGAAGATATTCACCATTATAGAGAACAAATTAAAAGAGTTAAGGACTCTGAAGATGTACCTATGGTCCTAGTAGGAAATAAATGTGATTTGCCTTCTAGAACAGTAGACACAAAACAGGCTCAGGA

Ensembl | human accession no.

ENSG00000133703

NCBI accession no.

NM_033360

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... KRAS(3845) , KRAS(3845)

Related Categories

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Qian Fan et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 44(4), 1311-1324 (2017-11-29)
MicroRNAs (miRNAs) have emerged as major regulators of tumour development and progression in non-small cell lung cancer (NSCLC). However, the role of miR-193a-3p in NSCLC is still unclear. Quantitative RT-PCR was used to detect miR-193a-3p expression levels in NSCLC tumour
Clinically Viable Gene Expression Assays with Potential for Predicting Benefit from MEK Inhibitors.
Roz Brant et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 23(6), 1471-1480 (2016-10-14)
Xinquan Liu et al.
International journal of nanomedicine, 14, 6589-6600 (2019-09-10)
The RAS family of oncogenes (KRAS, HRAS, NRAS) are the most frequent mutations in cancers and regulate key signaling pathways that drive tumor progression. As a result, drug delivery targeting RAS-driven tumors has been a long-standing challenge in cancer therapy.
Stella Liong et al.
Mediators of inflammation, 2018, 3645386-3645386 (2018-11-08)
Heightened placental inflammation and dysfunction are commonly associated in pregnant obese women compared to their pregnant lean counterparts. The small GTPase superfamily members known as the rat sarcoma viral oncogene homolog (Ras) proteins, in particular, the K-Ras and H-Ras isoforms
Ping-Chih Hsu et al.
Journal of cellular and molecular medicine, 22(6), 3073-3085 (2018-03-27)
Yes-associated protein (YAP) is a main mediator of the Hippo pathway and promotes cancer development and progression in human lung cancer. We sought to determine whether inhibition of YAP suppresses metastasis of human lung adenocarcinoma in a murine model. We
View All Related Papers

Articles

esiRNA Knockdown Efficiency Tested by Western Blotting

Quantitative and qualitative western blotting to validate knockdown by esiRNA.

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service