Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU110531

Sigma-Aldrich

MISSION® esiRNA

targeting human PPIB

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ATGTAGGCCGGGTGATCTTTGGTCTCTTCGGAAAGACTGTTCCAAAAACAGTGGATAATTTTGTGGCCTTAGCTACAGGAGAGAAAGGATTTGGCTACAAAAACAGCAAATTCCATCGTGTAATCAAGGACTTCATGATCCAGGGCGGAGACTTCACCAGGGGAGATGGCACAGGAGGAAAGAGCATCTACGGTGAGCGCTTCCCCGATGAGAACTTCAAACTGAAGCACTACGGGCCTGGCTGGGTGAGCATGGCCAACGCAGGCAAAGACACCAACGGCTCCCAGTTCTTCATCACGACAGTCAAGACAGCCTGGCTAGATGGCAAGCATGTGGTGTTTGGCAAAGTTCTAGAGGGCATGGAGGTGGTGCGGAAGGTGGAGAGCACCAAGACAGACAGCCGGGATAAACCCCTGAAGGATGTGATCATCGCAGACTGCGGCAAGATCGAGGTGGAGAAG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Paulo C M Urbano et al.
Frontiers in immunology, 10, 3047-3047 (2020-02-11)
Maintenance of regulatory T cells CD4+CD25highFOXP3+ (Treg) stability is vital for proper Treg function and controlling the immune equilibrium. Treg cells are heterogeneous and can reveal plasticity, exemplified by their potential to express IL-17A. TNFα-TNFR2 signaling controls IL-17A expression in
Ma Paz Zafra et al.
PloS one, 9(3), e91996-e91996 (2014-03-19)
Suppresors of cytokine signaling (SOCS) proteins regulate cytokine responses and control immune balance. Several studies have confirmed that SOCS3 is increased in asthmatic patients, and SOCS3 expression is correlated with disease severity. The objective of this study was to evaluate
Li Liu et al.
Retrovirology, 8, 94-94 (2011-11-16)
Upon cellular entry retroviruses must avoid innate restriction factors produced by the host cell. For human immunodeficiency virus (HIV) human restriction factors, APOBEC3 (apolipoprotein-B-mRNA-editing-enzyme), p21 and tetherin are well characterised. To identify intrinsic resistance factors to HIV-1 replication we screened
Maria M Caffarel et al.
The Journal of pathology, 231(2), 168-179 (2013-06-15)
Oncostatin M receptor (OSMR) is commonly over-expressed in advanced cervical squamous cell carcinoma (SCC), producing a significantly worse clinical outcome. Cervical SCC cells that over-express OSMR show enhanced responsiveness to the major ligand OSM, which induces multiple pro-malignant effects, including
Roberto A Avelar et al.
Genome biology, 21(1), 91-91 (2020-04-09)
Cellular senescence, a permanent state of replicative arrest in otherwise proliferating cells, is a hallmark of aging and has been linked to aging-related diseases. Many genes play a role in cellular senescence, yet a comprehensive understanding of its pathways is

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service