Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU086801

Sigma-Aldrich

MISSION® esiRNA

targeting human KLF10

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CGGGAACACCTGATTTTCATACAATCCCAGCATTTTGTTTGACTCCACCTTACAGTCCTTCTGACTTTGAACCCTCTCAAGTGTCAAATCTGATGGCACCAGCGCCATCTACTGTACACTTCAAGTCACTCTCAGATACTGCCAAACCTCACATTGCCGCACCTTTCAAAGAGGAAGAAAAGAGCCCAGTATCTGCCCCCAAACTCCCCAAAGCTCAGGCAACAAGTGTGATTCGTCATACAGCTGATGCCCAGCTATGTAACCACCAGACCTGCCCAATGAAAGCAGCCAGCATCCTCAACTATCAGAACAATTCTTTTAGAAGAAGAACCCACCTAAATGTTGAGGCTGCAAGAAAGAACATACCATGTGCCGCTGTGTCACCAAACAGATCCAAATGTGAGAGAAACACAGTGGCAGATGTTGATGAGA

Ensembl | human accession no.

ENSG00000155090

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... KLF10(7071) , KLF10(7071)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Abigail A Delaney et al.
Biology of reproduction, 95(3), 62-62 (2016-08-05)
Endometriosis is a highly prevalent, chronic, heterogeneous, fibro-inflammatory disease that remains recalcitrant to conventional therapy. We previously showed that loss of KLF11, a transcription factor implicated in uterine disease, results in progression of endometriosis. Despite extensive homology, co-expression, and human
Vivek Kumar Mishra et al.
Cancer research, 77(9), 2387-2400 (2017-03-03)
TGFβ-SMAD signaling exerts a contextual effect that suppresses malignant growth early in epithelial tumorigenesis but promotes metastasis at later stages. Longstanding challenges in resolving this functional dichotomy may uncover new strategies to treat advanced carcinomas. The Krüppel-like transcription factor, KLF10
Malayannan Subramaniam et al.
Journal of cellular physiology, 233(4), 3540-3551 (2017-10-19)
TIEG knockout (KO) mice exhibit a female-specific osteopenic phenotype and altered expression of TIEG in humans is associated with osteoporosis. Gene expression profiling studies identified sclerostin as one of the most highly up-regulated transcripts in the long bones of TIEG
Jong Min Lee et al.
Molecular therapy. Nucleic acids, 17, 310-322 (2019-07-10)
We investigated the functional role of miR-892b as a novel inhibitor of chondrocyte hypertrophy during TGF-β-mediated chondrogenesis of human mesenchymal stem cells (hMSCs). The expression of miR-892b during TGF-β-mediated chondrogenesis of hMSCs and the effects of miR-892b overexpression on chondrogenic
Chun-Liang Lin et al.
EMBO molecular medicine, 11(5) (2019-04-06)
Diabetic nephropathy is the leading cause of end-stage renal disease. Although dysfunction of podocytes, also termed glomerular visceral epithelial cells, is critically associated with diabetic nephropathy, the mechanism underlying podocyte dysfunction still remains obscure. Here, we identify that KDM6A, a

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service