Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU078971

Sigma-Aldrich

MISSION® esiRNA

targeting human TFRC

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGCCAGCAAAGTTGAGAAACTCACTTTAGACAATGCTGCTTTCCCTTTCCTTGCATATTCTGGAATCCCAGCAGTTTCTTTCTGTTTTTGCGAGGACACAGATTATCCTTATTTGGGTACCACCATGGACACCTATAAGGAACTGATTGAGAGGATTCCTGAGTTGAACAAAGTGGCACGAGCAGCTGCAGAGGTCGCTGGTCAGTTCGTGATTAAACTAACCCATGATGTTGAATTGAACCTGGACTATGAGAGGTACAACAGCCAACTGCTTTCATTTGTGAGGGATCTGAACCAATACAGAGCAGACATAAAGGAAATGGGCCTGAGTTTACAGTGGCTGTATTCTGCTCGTGGAGACTTCTTCCGTGCTACTTCCAGACTAACAACAGATTTCGGGAATGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Jason W Dang et al.
Cell reports, 27(12), 3618-3628 (2019-06-20)
Zika virus (ZIKV) infection is implicated in severe fetal developmental disorders, including microcephaly. MicroRNAs (miRNAs) post-transcriptionally regulate numerous processes associated with viral infection and neurodegeneration, but their contribution to ZIKV pathogenesis is unclear. We analyzed the mRNA and miRNA transcriptomes of human
Hongwei Su et al.
Molecular cancer, 18(1), 27-27 (2019-02-21)
Circular RNA (circRNA) represents a broad and diverse endogenous RNAs that can regulate gene expression in cancer. However, the regulation and function of bladder cancer (BC) circRNAs remain largely unknown. Here we generated circRNA microarray data from three BC tissues
Yihe Wu et al.
Thoracic cancer, 9(2), 253-261 (2017-12-30)
Transferrin receptor (TfR) is expressed in most lung cancers and is an indicator of poor prognosis in certain groups of patients. In this study, we blocked cell surface TfR to inhibit lung adenocarcinoma (LAC) cell growth in vitro and investigated
Xinjian Lin et al.
Oncoscience, 1(3), 185-195 (2015-01-17)
The αV integrin is expressed in most cancer cells where it regulates a diverse array of cellular functions essential to the initiation, progression and metastasis of solid tumors. However, little is known about how αV integrin modulates cellular sensitivity to
Julie Mazzolini et al.
The Biological bulletin, 231(1), 40-60 (2016-09-18)
Particles present in diesel exhaust have been proposed as a significant contributor to the development of acute and chronic lung diseases, including respiratory infection and allergic asthma. Nanoceria (CeO2 nanoparticles) are used to increase fuel efficiency in internal combustion engines

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service