Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU076761

Sigma-Aldrich

MISSION® esiRNA

targeting human EGFR

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TAACAAGCTCACGCAGTTGGGCACTTTTGAAGATCATTTTCTCAGCCTCCAGAGGATGTTCAATAACTGTGAGGTGGTCCTTGGGAATTTGGAAATTACCTATGTGCAGAGGAATTATGATCTTTCCTTCTTAAAGACCATCCAGGAGGTGGCTGGTTATGTCCTCATTGCCCTCAACACAGTGGAGCGAATTCCTTTGGAAAACCTGCAGATCATCAGAGGAAATATGTACTACGAAAATTCCTATGCCTTAGCAGTCTTATCTAACTATGATGCAAATAAAACCGGACTGAAGGAGCTGCCCATGAGAAATTTACAGGAAATCCTGCATGGCGCCGTGCGGTTCAGCAACAACCCTGCCCTGTGCAACGTGGAGAGCATCCAGTGGCGGGACATAGTCAGCAGTGACTTTCTCAGCAACATGTCGATGGACTTCCAGAACCAC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Meifang Li et al.
Journal of experimental & clinical cancer research : CR, 38(1), 211-211 (2019-05-24)
Epidermal growth factor receptor (EGFR) and epidermal growth factor receptor pathway substrate 8 (Eps8) have been widely reported to be expressed in various tumors. Eps8 is an important active kinase substrate of EGFR that directly binds to the juxtamembrane (JXM)
Yi-Yang Peng et al.
Biomacromolecules, 19(10), 4052-4058 (2018-08-31)
Strong signaling cascades derived from upregulation and overexpression of growth factors such as the EGF-family (epidermal growth factors) have been crucially related to cancer pathogenesis. Gene silencing techniques to modulate the expression of oncogenes and tumor suppresor genes are a
Katia Rea et al.
Journal of experimental & clinical cancer research : CR, 37(1), 146-146 (2018-07-13)
The disruption of E-cadherin-mediated adhesion is considered an important driver of tumor progression. Nevertheless, numerous studies have demonstrated that E-cadherin promotes growth- or invasion-related signaling, contrary to the prevailing notion. During tumor progression, epithelial ovarian cancer (EOC) maintains E-cadherin expression
Ijeoma Adaku Umelo et al.
Lung cancer (Amsterdam, Netherlands), 90(2), 167-174 (2015-09-08)
Lung cancer remains the leading cause of cancer-related mortality worldwide, with metastatic disease frequently a prominent feature at the time of diagnosis. The role of NSCLC-derived EGFR mutations in cancer cell proliferation and survival has been widely reported, but little
Jia Shen et al.
Journal of experimental & clinical cancer research : CR, 37(1), 157-157 (2018-07-19)
Lycorine has been revealed to inhibit the development of many kinds of malignant tumors, including glioblastoma multiforme (GBM). Although compelling evidences demonstrated Lycorine's inhibition on cancers through some peripheral mechanism, in-depth mechanism studies of Lycotine's anti-GBM effects still call for

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service