Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU074691

Sigma-Aldrich

MISSION® esiRNA

targeting human GABPA

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCAGAGTGCACAGAAGAAAGCATTGTAGAACAAACCTACGCGCCAGCTGAATGTGTAAGCCAGGCCATAGACATCAATGAACCAATAGGCAATTTAAAGAAACTGCTAGAACCAAGACTACAGTGTTCTTTGGATGCTCATGAAATTTGTCTGCAAGATATCCAGCTGGATCCAGAACGAAGTTTATTTGACCAAGGAGTAAAAACAGATGGAACTGTACAGCTTAGTGTACAGGTAATTTCTTACCAAGGAATTGAACCAAAGTTAAACATCCTTGAAATTGTTAAACCTGCGGACACTGTTGAGGTTGTTATTGATCCAGATGCCCACCATGCTGAATCAGAAGCACATCTTGTTGAAGAAGCTCAAGTGATAACTCTTGATGGCACAAAACACATCACAACCATTTCAGATGAAACTTCAGAACAAGTGACAAGATGGGCTGCT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Lingjie Bao et al.
Molecular carcinogenesis, 56(6), 1543-1553 (2017-01-24)
Previously, we have demonstrated that NRF2 plays a key role in mediating cisplatin resistance in ovarian cancer. To further explore the mechanism underlying NRF2-dependent cisplatin resistance, we stably overexpressed or knocked down NRF2 in parental and cisplatin-resistant human ovarian cancer
Yasutaka Mitamura et al.
Oxidative medicine and cellular longevity, 2018, 2475047-2475047 (2018-09-07)
Systemic fibrosing or sclerotic disorders are life-threatening, but only very limited treatment modalities are available for them. In recent years, periostin (POSTN), a major extracellular matrix component, was established by several studies as a novel key player in the progression
Yun Peng Shao et al.
Neurourology and urodynamics, 37(8), 2470-2479 (2018-06-20)
The present work evaluated preventive effect of curcumin on cisplatin-induced bladder cystopathy. Fifteen female rats were divided into (i) Control group administered with physiological saline solution for 5 days; (ii) Cis-P group injected with cisplatin (6 mg/kg); and (iii) Cis-Cur group
Kanako Ono et al.
Placenta, 75, 34-41 (2019-02-05)
Polyunsaturated fatty acids (PUFAs), including arachidonic acid (AA), eicosapentaenoic acid (EPA), and docosahexaenoic acid (DHA), are essential for adequate fetal growth. The aim of the present study was to elucidate the effects of PUFAs on the expression and function of
Limin Xu et al.
Frontiers in cell and developmental biology, 8, 569977-569977 (2020-10-31)
Cerebral ischemic injury is a complicated pathological process. Adipose-derived stromal cells (ADSCs) have been used as a therapeutic strategy, with their therapeutic effects chiefly attributed to paracrine action rather than trans-differentiation. Studies have shown that circAkap7 was found to be

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service