Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU070211

Sigma-Aldrich

MISSION® esiRNA

targeting human TRPC1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTTGGAAAATTTCTTGGGATGTTTCTTCTTGTTTTGTTTTCTTTCACAATTGGACTGACACAACTGTATGATAAAGGATATACTTCAAAGGAGCAGAAGGACTGTGTAGGCATCTTCTGTGAACAGCAAAGCAATGATACCTTCCATTCGTTCATTGGCACCTGCTTTGCTTTGTTCTGGTATATTTTCTCCTTAGCGCATGTGGCAATCTTTGTCACAAGATTTAGCTATGGAGAAGAACTGCAGTCCTTTGTGGGAGCTGTCATTGTTGGTACATACAATGTCGTGGTTGTGATTGTGCTTACCAAACTGCTGGTGGCAATGCTTCATAAAAGCTTTCAGTTGATAGCAAATCATGAAGACAAAGAATGGAAGTTTGCTCGAGCAAAATTATGGCTTAGCTACTTTGATGACAAATGTACGTTACCTCCACCTTTCAACATCATTCCCTCACCA

Ensembl | human accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Qinqin Pu et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 33(1), 1074-1085 (2018-08-02)
Airway remodeling with progressive epithelial alterations in the respiratory tract is a severe consequence of asthma. Although dysfunctional signaling transduction is attributed to airway inflammation, the exact mechanism of airway remodeling remains largely unknown. TRPC1, a member of the transient
Corena V Grant et al.
Breast cancer research and treatment, 177(2), 345-355 (2019-06-24)
Triple-negative breast cancers (TNBCs) represent a heterogeneous group of tumors. The lack of targeted therapies combined with the inherently aggressive nature of TNBCs results in a higher relapse rate and poorer overall survival. We evaluated the heterogeneity of TNBC cell
Xiaoyu Zhang et al.
Journal of cellular biochemistry, 119(7), 6033-6044 (2018-03-27)
This study aimed to validate whether transient receptor potential channel1 (TRPC1) and TRPC3 participate in the regulation the proliferation of airway smooth muscle cells (ASMCs) through modulating calcium ion (Ca2+ ) influx in vitro. Chronic model of murine asthma was
Michael F Emmons et al.
Scientific reports, 7(1), 2685-2685 (2017-06-05)
The emergence of drug resistance continues to be a major hurdle towards improving patient outcomes for the treatment of Multiple Myeloma. MTI-101 is a first-in-class peptidomimetic that binds a CD44/ITGA4 containing complex and triggers necrotic cell death in multiple myeloma
Yuyang Sun et al.
Journal of cellular physiology, 230(11), 2848-2856 (2015-04-23)
Calcium-activated chloride channel (CaCC) plays an important role in modulating epithelial secretion. It has been suggested that in salivary tissues, sustained fluid secretion is dependent on Ca(2+) influx that activates ion channels such as CaCC to initiate Cl(-) efflux. However

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service