Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU061411

Sigma-Aldrich

MISSION® esiRNA

targeting human PLXNB2

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTTCTTCCTGCCCTCCAAGGACGGCGACAAGGACGTGATGATCACCGGCAAGCTGGACATCCCTGAGCCGCGGCGGCCGGTGGTGGAGCAGGCCCTCTACCAGTTCTCCAACCTGCTGAACAGCAAGTCTTTCCTCATCAATTTCATCCACACCCTGGAGAACCAGCGGGAGTTCTCGGCCCGCGCCAAGGTCTACTTCGCGTCCCTGCTGACGGTGGCGCTGCACGGGAAACTGGAGTACTACACGGACATCATGCACACGCTCTTCCTGGAGCTCCTGGAGCAGTACGTGGTGGCCAAGAACCCCAAGCTGATGCTGCGCAGGTCTGAGACTGTGGTGGAGAGGATGCTGTCCAACTGGATGTCCATCTGCCTGTACCAGTACCTCAAGGACAGTGCCGGGGAGCCCCTGTACAAGCTCTTCAAGGCCATCAAACATCAGGTGGAAAAGGGCCCGGTGGATGCGGTACAGAAGAAGGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Brad McColl et al.
Journal of cell science, 129(21), 4046-4056 (2016-11-03)
Rnd proteins are atypical members of the Rho GTPase family that induce actin cytoskeletal reorganization and cell rounding. Rnd proteins have been reported to bind to the intracellular domain of several plexin receptors, but whether plexins contribute to the Rnd-induced
Ying Zhang et al.
Cellular signalling, 62, 109343-109343 (2019-06-10)
Plexin-B2 (PLXNB2), a transmembrane protein is found in various tissues. Recent studies have indicated the presence of PLXNB2 in large quantity in the growth plates of Sprague-Dawley rats and are believed to be potentially involved in their skeletal development. This
Audrey P Le et al.
Oncotarget, 6(9), 7293-7304 (2015-03-13)
Invasive growth is a major determinant of the high lethality of malignant gliomas. Plexin-B2, an axon guidance receptor important for mediating neural progenitor cell migration during development, is upregulated in gliomas, but its function therein remains poorly understood. Combining bioinformatic
Daisuke Ito et al.
Journal of immunology (Baltimore, Md. : 1950), 195(3), 934-943 (2015-06-28)
Mammalian target of rapamycin (mTOR) plays crucial roles in activation and differentiation of diverse types of immune cells. Although several lines of evidence have demonstrated the importance of mTOR-mediated signals in CD4(+) T cell responses, the involvement of mTOR in

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service