Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU058661

Sigma-Aldrich

MISSION® esiRNA

targeting human ROBO2

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCTCCTCCAGATCACCAGAATGGAATTATCCAAGAATACAAGATCTGGTGTCTAGGAAATGAAACGCGATTCCATATCAACAAAACTGTGGATGCAGCCATTCGGTCCGTAATAATTGGTGGATTATTCCCAGGTATTCAATACCGGGTAGAGGTTGCAGCTAGTACCAGTGCAGGGGTTGGAGTAAAGAGTGAGCCACAGCCAATAATAATCGGGAGACGCAATGAAGTTGTCATTACTGAAAACAATAACAGCATAACTGAGCAAATCACTGATGTGGTGAAGCAACCAGCCTTTATAGCTGGTATTGGTGGTGCCTGCTGGGTAATTCTGATGGGTTTTAGCATATGGTTGTATTGGCGAAGAAAGAAGAGGAAGGGACTCAGTAATTATGCTGTTACGTTTCAAAGAGGAGATGGAGGACTAATGAGCAATGGAAGCCGT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Tian-Ping Chen et al.
Molecular medicine (Cambridge, Mass.), 27(1), 21-21 (2021-03-05)
Studies have found that circular RNAs (circRNAs) play key roles in cardiovascular diseases. However, the function of circROBO2 in acute myocardial infarction (AMI) is unclear. This study aimed to investigate the pathogenesis of circROBO2 in AMI. qRT-PCR and Western blot
Zhiping Zeng et al.
Life sciences, 203, 39-47 (2018-04-17)
Slit/Robo signaling was originally identified as a repulsive guidance cue in regulating axon branching and neuronal migration. Hepatic stellate cells (HSCs) are the key fibrogenic cells in the liver, which are migratory when activated, and express neural crest markers. The
Gael Genet et al.
Nature communications, 10(1), 2350-2350 (2019-05-30)
Endothelial cell migration, proliferation and survival are triggered by VEGF-A activation of VEGFR2. However, how these cell behaviors are regulated individually is still unknown. Here we identify Endophilin-A2 (ENDOA2), a BAR-domain protein that orchestrates CLATHRIN-independent internalization, as a critical mediator
Feng Zhang et al.
Nature communications, 7, 13517-13517 (2016-11-25)
Vascular permeability and neovascularization are implicated in many diseases including retinopathies and diabetic wound healing. Robo4 is an endothelial-specific transmembrane receptor that stabilizes the vasculature, as shown in Robo4

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service