Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU055711

Sigma-Aldrich

MISSION® esiRNA

targeting human RBX1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGCAGGAACCACATTATGGATCTTTGCATAGAATGTCAAGCTAACCAGGCGTCCGCTACTTCAGAAGAGTGTACTGTCGCATGGGGAGTCTGTAACCATGCTTTTCACTTCCACTGCATCTCTCGCTGGCTCAAAACACGACAGGTGTGTCCATTGGACAACAGAGAGTGGGAATTCCAAAAGTATGGGCACTAGGAAAAGACTTCTTCCATCAAGCTTAATTGTTTTGTTATTCATTTAATGACTTTCCCTGCTGTTACCTAATTACAAATTGGATGGAACTGTGTTTTTTTCTGCTTTGTTTTTTCAGTTTGCTGTTTCTGTAGCCATATTGTATTCTGTGTCAAATAAAGTCCAGTTGGATTCTGGAACGGATG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Tomohiro Kunishige et al.
Oncology letters, 20(3), 2919-2927 (2020-08-13)
Ring box protein-1 (RBX1) is an essential component of the S-phase kinase-associated protein, Cullin and F-box containing ubiquitin ligases. Overexpression of RBX1 has been reported in several cancer types; however, little is known regarding the prognostic value and role of
Kazuhiro Migita et al.
Gastric cancer : official journal of the International Gastric Cancer Association and the Japanese Gastric Cancer Association, 17(4), 601-609 (2013-12-03)
RING box protein-1 (RBX1) is an essential component of the E3 ubiquitin ligase Skp1/Cullin/RBX1/F-box protein complex. Although an altered expression of RBX1 has been reported in several human cancers, the role of RBX1 in gastric cancer remains unknown. We investigated
Fan Yao et al.
Nature communications, 9(1), 2269-2269 (2018-06-13)
Dysregulation of YAP localization and activity is associated with pathological conditions such as cancer. Although activation of the Hippo phosphorylation cascade is known to cause cytoplasmic retention and inactivation of YAP, emerging evidence suggests that YAP can be regulated in

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service