Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU050261

Sigma-Aldrich

MISSION® esiRNA

targeting human FRZB

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AAACTGTAGAGGGGCAAGCAGTGAACGCTGTAAATGTAAGCCTATTAGAGCTACACAGAAGACCTATTTCCGGAACAATTACAACTATGTCATTCGGGCTAAAGTTAAAGAGATAAAGACTAAGTGCCATGATGTGACTGCAGTAGTGGAGGTGAAGGAGATTCTAAAGTCCTCTCTGGTAAACATTCCACGGGACACTGTCAACCTCTATACCAGCTCTGGCTGCCTCTGCCCTCCACTTAATGTTAATGAGGAATATATCATCATGGGCTATGAAGATGAGGAACGTTCCAGATTACTCTTGGTGGAAGGCTCTATAGCTGAGAAGTGGAAGGATCGACTCGGTAAAAAAGTTAAGCGCTGGGATATGAAGCTTCGTCATCTTGGACTCAGTAAAAGTGATTCTAGCAATAGTGATTCCACTCAGAGTCAGAAGTCTGGCAGGAACTCGAA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

De-Zhi Zheng et al.
Current neurovascular research, 14(1), 32-38 (2017-04-07)
Periprosthetic osteolysis induced by wear particles can lead to aseptic loosening, one main reason of arthroplasty failure. However, the role of microRNA-130b (miR-130b) in particle-induced osteolysis (PIO) has not been explored yet. In this study, PIO models were established in
Liang-Jie Wang et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 33(1), 314-326 (2018-07-07)
Migration of placental extravillous trophoblast (EVT) cells into uterine decidua facilitates the establishment of blood circulation between mother and fetus and is modulated by EVT-decidual cell interaction. Poor or excessive EVT migration is associated with pregnancy complications such as preeclampsia
Julie J G Kephart et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 21(21), 4868-4880 (2015-06-14)
Rhabdomyosarcoma (RMS) is a soft tissue sarcoma associated with the skeletal muscle lineage. Of the two predominant subtypes, known as embryonal (eRMS) and alveolar (aRMS), aRMS has the poorer prognosis, with a five-year survival rate of <50%. The majority of

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service