Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU039411

Sigma-Aldrich

MISSION® esiRNA

targeting human SAG

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTGCGGTCTCTCTCAACAAAGAGATCTATTTCCATGGGGAGCCCATCCCTGTGACCGTGACTGTCACCAATAACACAGAGAAGACCGTGAAGAAGATTAAAGCATTCGTGGAACAGGTGGCCAATGTGGTTCTCTACTCGAGTGATTATTACGTCAAGCCCGTGGCTATGGAGGAAGCGCAAGAAAAAGTGCCACCAAACAGCACTTTGACCAAGACGCTGACGCTGCTGCCCTTGCTGGCTAACAATCGAGAAAGGAGAGGCATTGCCCTGGATGGGAAAATCAAGCACGAGGACACAAACCTTGCCTCCAGCACCATCATTAAGGAGGGCATAGACCGGACCGTCCTGGGAATCCTGGTGTCTTACCAGATCAAGGTGAAGCTCACAGTGTCAGGCTTGGGAGAGA

Ensembl | human accession no.

ENSG00000130561

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... SAG(6295) , SAG(6295)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Zhi-Yu Song et al.
Oncogene, 38(9), 1560-1575 (2018-10-20)
Both chemokine receptors (CXCRs) 7 and 4 can facilitate immune cell migration and mediate a vast array of physiological and pathological events. Herein we report, in both human and animal studies, that these two CXCRs can form heterodimers in vivo
Taehyung Lee et al.
Journal of cellular physiology, 231(5), 992-1000 (2015-10-20)
β-Arrestins are multifunctional scaffolding proteins that modulate G protein-coupled receptor (GPCR)-dependent and -independent cell signaling pathways in various types of cells. We recently demonstrated that β-arrestin1 (β-arr1) deficiency strikingly attenuates dextran sodium sulfate (DSS)-induced colitis in mice. Since DSS-induced colitis
Benedetta Assetta et al.
Cell reports, 27(7), 1960-1966 (2019-05-16)
JC polyomavirus (JCPyV) is a ubiquitous human pathogen that causes progressive multifocal leukoencephalopathy (PML). The entry receptors for JCPyV belong to the 5-hydroxytryptamine 2 receptor (5-HT2R) family, but how individual members of the family function to facilitate infection is not
Colleen L Mayberry et al.
Journal of virology, 93(8) (2019-02-01)
JC polyomavirus (JCPyV) establishes a persistent, lifelong, asymptomatic infection within the kidney of the majority of the human population. Under conditions of severe immunosuppression or immune modulation, JCPyV can reactivate in the central nervous system (CNS) and cause progressive multifocal
S C Chang et al.
Cell death and differentiation, 21(9), 1388-1398 (2014-05-03)
The checkpoint between the life and death of macrophages is crucial for the host's frontline immune defense during acute phase infection. However, the mechanism as to how the immune cell equilibrates between apoptosis and immune response is unclear. Using in

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service