Skip to Content
MilliporeSigma
All Photos(1)

Documents

EHU015561

Sigma-Aldrich

MISSION® esiRNA

targeting human PLAU

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGAGGTGGAAAACCTCATCCTACACAAGGACTACAGCGCTGACACGCTTGCTCACCACAACGACATTGCCTTGCTGAAGATCCGTTCCAAGGAGGGCAGGTGTGCGCAGCCATCCCGGACTATACAGACCATCTGCCTGCCCTCGATGTATAACGATCCCCAGTTTGGCACAAGCTGTGAGATCACTGGCTTTGGAAAAGAGAATTCTACCGACTATCTCTATCCGGAGCAGCTGAAAATGACTGTTGTGAAGCTGATTTCCCACCGGGAGTGTCAGCAGCCCCACTACTACGGCTCTGAAGTCACCACCAAAATGCTGTGTGCTGCTGACCCACAGTGGAAAACAGATTCCTGCCAGGGAGACTCAGGGGGACCCCTCGTCTGTTCCCTCCAAGGCCGCATGACTTTGACTGGAATTGTGAGCTGG

Ensembl | human accession no.

ENSG00000122861

NCBI accession no.

NM_002658

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... PLAU(5328) , PLAU(5328)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Peng Liu et al.
Scientific reports, 6, 37606-37606 (2016-11-22)
Pancreatic cancer is a highly metastatic and chemo-resistant disease. Secreted proteins involved in cell-cell interactions play an important role in changing the tumor microenvironment. Previous studies generally focus on the secretome of cancer cell line from serum-free media, due to
Anuradha Moirangthem et al.
Scientific reports, 6, 21903-21903 (2016-02-26)
In cancer progression, proteolytic enzymes like serine proteases and metalloproteinases degrade the basement membrane enabling the tumor cells to invade the adjacent tissues. Thus, invasion and metastasis are augmented by these enzymes. Simultaneous silencing of uPA and MMP9 in breast
Xin Zhao et al.
European journal of pharmacology, 880, 173225-173225 (2020-05-29)
Tripterygium wilfordii Hook F (TwHF) exhibits anti-tumor efficacy in pancreatic ductal adenocarcinoma (PDAC), however the pharmacological mechanisms are unclear due to complicated formulae and target genes. Using Traditional Chinese Medicine Systems Pharmacology and GeneCards databases, we performed a network pharmacology
Rishi K Jaiswal et al.
BioFactors (Oxford, England), 45(5), 803-817 (2019-07-19)
Telomerase is a specialized reverse transcriptase/terminal transferase enzyme that adds telomeric repeat sequences at the extreme end of a newly replicated chromosome. Apart from telomere lengthening, telomerase has many extracurricular activities. Telomerase is known to regulate the expression of many
Hai Li et al.
Integrative cancer therapies, 17(2), 511-523 (2017-06-20)
Gastric cancer (GC) is a malignancy with few effective treatment options after metastasis occurs. Quercetin (Qu) intake has been associated with reduced incidence and slow development of GC, probably due to its anti-proliferative and apoptotic effects, but it is unclear
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service