Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU014941

Sigma-Aldrich

MISSION® esiRNA

targeting human ABL2

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGGCGTCTGGAAGAAATACAGCCTTACAGTTGCTGTGAAAACATTGAAGGAAGATACCATGGAGGTAGAAGAATTCCTGAAAGAAGCTGCAGTAATGAAGGAAATCAAGCATCCTAATCTGGTACAACTTTTAGGTGTGTGTACTTTGGAGCCACCATTTTACATTGTGACTGAATACATGCCATACGGGAATTTGCTGGATTACCTCCGAGAATGCAACCGAGAAGAGGTGACTGCAGTTGTGCTGCTCTACATGGCCACTCAGATTTCTTCTGCAATGGAGTACTTAGAGAAGAAGAATTTCATCCATAGAGATCTTGCAGCTCGTAACTGCCTAGTGGGAGAAAACCATGTGGTAAAAGTGGCTGACTTTGGCTTAAGTAGATTGATGACTGGAGACACTTATACTGCTCATGCTGGAGCCAAATTTCCTATTAAGTGGACAGCACCAGAGAGTCTTGCCTACAATACCTTCTCAATTAAATCTGACGTCTGGGCTTTTGGGGTATT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... ABL2(27) , ABL2(27)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

H Gil-Henn et al.
Oncogene, 32(21), 2622-2630 (2012-07-11)
Tumor progression is a complex, multistep process involving accumulation of genetic aberrations and alterations in gene expression patterns leading to uncontrolled cell division, invasion into surrounding tissue and finally dissemination and metastasis. We have previously shown that the Arg/Abl2 non-receptor
Xiu-Fen Ming et al.
Journal of the American Heart Association, 1(4), e000992-e000992 (2012-11-07)
Macrophage-mediated chronic inflammation is mechanistically linked to insulin resistance and atherosclerosis. Although arginase I is considered antiinflammatory, the role of arginase II (Arg-II) in macrophage function remains elusive. This study characterizes the role of Arg-II in macrophage inflammatory responses and
Takafumi Ichikawa et al.
Journal of cell science, 130(20), 3517-3531 (2017-09-03)
Vinexin, c-Cbl associated protein (CAP) and Arg-binding protein 2 (ArgBP2) constitute an adaptor protein family called the vinexin (SORBS) family that is targeted to focal adhesions (FAs). Although numerous studies have focused on each of the SORBS proteins and partially
Alicia N Rizzo et al.
Vascular pharmacology, 128-129, 106677-106677 (2020-04-03)
Acute Respiratory Distress Syndrome (ARDS) is a devastating disease process that involves dysregulated inflammation and decreased alveolar-capillary barrier function. Despite increased understanding of the pathophysiology, no effective targeted therapies exist to treat ARDS. Recent preclinical studies suggest that the multi-tyrosine
Ewelina Testoni et al.
EMBO molecular medicine, 8(2), 105-116 (2016-01-14)
The lack of actionable mutations in patients with non-small cell lung cancer (NSCLC) presents a significant hurdle in the design of targeted therapies for this disease. Here, we identify somatically mutated ABL1 as a genetic dependency that is required to

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service