Recommended Products
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GCCTGTACTGGACCACACCTTCTGCGTGGAACACAACGCCTTCGGGCGGATCCTGCAGCATGAACTGAAACCCAATGGCAGAAATGTGCCAGTCACAGAGGAGAATAAGAAAGAATACGTCCGGTTGTATGTAAACTGGAGGTTTATGAGAGGAATCGAAGCCCAGTTCTTAGCTCTGCAGAAGGGGTTCAATGAGCTCA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... SMURF1(57154) , SMURF1(57154)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
K Koefoed et al.
Scientific reports, 8(1), 9542-9542 (2018-06-24)
Smad ubiquitin regulatory factor 1 (SMURF1) is a HECT-type E3 ubiquitin ligase that plays a critical role in vertebrate development by regulating planar cell polarity (PCP) signaling and convergent extension (CE). Here we show that SMURF1 is involved in mammalian
Youmao Tao et al.
Oncology reports, 38(3), 1806-1814 (2017-07-22)
Smad ubiquitin regulatory factor 1 (SMURF1), a well-known E3 ubiquitin ligase, targets substrate proteins for ubiquitination and proteasomal degradation. Accumulating studies have shown that SMURF1 acts as an oncogenic factor in human malignancies. However, the clinical significance of SMURF1 and its
Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.
Contact Technical Service