Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU107461

Sigma-Aldrich

MISSION® esiRNA

targeting human RPS6KB1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CATCCCTTCATCGTGGATTTAATTTATGCCTTTCAGACTGGTGGAAAACTCTACCTCATCCTTGAGTATCTCAGTGGAGGAGAACTATTTATGCAGTTAGAAAGAGAGGGAATATTTATGGAAGACACTGCCTGCTTTTACTTGGCAGAAATCTCCATGGCTTTGGGGCATTTACATCAAAAGGGGATCATCTACAGAGACCTGAAGCCGGAGAATATCATGCTTAATCACCAAGGTCATGTGAAACTAACAGACTTTGGACTATGCAAAGAATCTATTCATGATGGAACAGTCACACACACATTTTGTGGAACAATAGAATACATGGCCCCTGAAATCTTGATGAGAAGTGGCCACAATCGTGCTGTGGATTGGTGGAGTTTGGGAGCATTAATGTATGACATGCTGACTGGAGCACCCCCATTCACTGGGGAGAATAGAAAGAAAACAATTGACAAAATCCTCAAATGTAAACTCAATTTGCCTCCCTACCTCACAC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Suleman S Hussain et al.
Cancer letters, 433, 232-241 (2018-07-14)
Radiation therapy (XRT) is a standard treatment for prostate cancer (PCa). Although dose escalation increases local control, toxicity hampers further escalation. Broader improvement will be possible by the addition of adjuvant therapies, which can synergize with radiation and thus improve
Subin Jin et al.
Journal of Korean medical science, 32(8), 1327-1336 (2017-07-01)
Microarray analysis was used to investigate the lack of identified mammalian target of rapamycin (mTOR) pathway downstream genes to overcome cross-talk at non-muscle invasive high-grade (HG)-urothelial carcinoma (UC) of the bladder, gene expression patterns, gene ontology, and gene clustering by
Tao Zhang et al.
International journal of molecular sciences, 15(2), 3154-3171 (2014-02-26)
The tumor necrosis factor-related apoptosis-inducing ligand (TRAIL), either alone or in combination with other anti-cancer agents, has been considered as a new strategy for anti-cancer therapy. In this study, we demonstrated that evodiamine, a quinolone alkaloid isolated from the fruit
Ju Hyun Shin et al.
Scientific reports, 3, 1561-1561 (2013-03-28)
There is growing interest in identifying regulators of autophagy. The molecular mechanism underlying transforming growth factor-β activated kinase 1 (TAK1)-induced autophagy is poorly understood. We found that TAK1 inhibits p70 S6 kinase1 (S6K1) phosphorylation by interfering interaction of raptor with
Ye Wang et al.
International journal of radiation biology, 93(6), 581-589 (2017-03-10)
Ribosomal S6 kinase 1 (S6K1) plays an important role in cell proliferation, protein translation and cell survival. This study investigated the possibility of using S6K1 as a new target in the radiotherapy of non-small cell lung cancer (NSCLC) and its

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service