Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Kluczowe dokumenty

EMU088711

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Atp11c

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych


About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

linia produktu

MISSION®

Formularz

lyophilized powder

sekwencja docelowa esiRNA cDNA

TTGAAAATGCAAAGCGAGTGAGGAAAGAAAGTGAAAAAATCAAGGTTGGTGATGTAGTAGAAGTACAGGCAAATGAAACCTTTCCCTGTGATCTTATACTTCTGTCATCCTGCACAACTGATGGAACCTGTTATGTCACTACAGCCAGTCTTGATGGTGAATCTAATTGCAAGACACATTATGCAGTACGAGATACCATTGCACTGTGTACAGCCGAATCCATTGATAATCTCCGAGCAACAATTGAATGTGAGCAGCCTCAACCTGATCTCTACAGGTTTGTTGGGCGAATCAGTATCTATAGTAATAGTATTGAGGCTGTTGCCAGGTCTTTGGGACCTGAAAATCTTTTGCTGAAAGGAGCCACACTTAAAAATACCAAGAAGATATATGGAGTTGCTGTTTACACTGGGATGGAAACCAAAATGGCTTTGAACTACCAAGGGAAATCTCAGAAATGTTCTGCTGTTGAAAAATCTATTAATGCCTTCTTGATTGTTTATTTATTTATCTTACTGACCAAAGCTGCAGTATGCA

Ensembl | numer dostępu dla gatunku mysz

numer dostępu NCBI

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

Opis ogólny

3355 esiRNA to siRNA przygotowane z użyciem endorybonukleazy. Stanowią one heterogeniczną mieszaninę siRNA, które celują w tę samą sekwencję mRNA. Te wielokrotne wyzwalacze wyciszania prowadzą do wysoce specyficznego i skutecznego wyciszania genów.

Aby uzyskać dodatkowe informacje, a także wyświetlić wszystkie dostępne opcje esiRNA, odwiedź SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable


Wybierz jedną z najnowszych wersji:

Certyfikaty analizy (CoA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Dokumenty section.

Proszę o kontakt, jeśli potrzebna jest pomoc Obsługa Klienta

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Paweł Jóźwiak et al.
Nutrition and cancer, 67(8), 1333-1341 (2015-09-19)
Enhanced glucose requirement of cancer cells is associated with an increased glucose transport across plasma membrane that is mediated by a family of facilitated glucose transporter proteins, named GLUTs. GLUT1 is the main transporter in thyroid cancer cells. Glucose is
Michael Moldavan et al.
The European journal of neuroscience, 42(12), 3018-3032 (2015-09-24)
GABA is a principal neurotransmitter in the suprachiasmatic hypothalamic nucleus (SCN), the master circadian clock. Despite the importance of GABA and GABA uptake for functioning of the circadian pacemaker, the localization and expression of GABA transporters (GATs) in the SCN
Taryn E Travis et al.
Journal of burn care & research : official publication of the American Burn Association, 36(3), e125-e135 (2014-07-23)
The duroc pig has been described as a promising animal model for use in the study of human wound healing and scar formation. However, little is known about the presence and chronology of the fibrocyte cell population in the healing
Chong-Shan Shi et al.
Journal of immunology (Baltimore, Md. : 1950), 193(6), 3080-3089 (2014-08-20)
Coronaviruses (CoV) have recently emerged as potentially serious pathogens that can cause significant human morbidity and death. The severe acute respiratory syndrome (SARS)-CoV was identified as the etiologic agent of the 2002-2003 international SARS outbreak. Yet, how SARS evades innate
Edith Suzarte et al.
International immunology, 27(8), 367-379 (2015-03-22)
Our group developed a subunit vaccine candidate against dengue virus based on two different viral regions: the domain III of the envelope protein and the capsid protein. The novel chimeric protein from dengue-2 virus [domain III-capsid (DIIIC-2)], when presented as

Global Trade Item Number

SKUGTIN
EMU088711-20UG4061828527335
EMU088711-50UG4061828866885

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej