Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Key Documents

EMU037461

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Bcl2

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

CTGCAAATGCTGGACTGAAAAATTGTAATTCATCTGCCGCCGCCGCCGCTGCCTTTTTGCCCCGCTGCGGTGCTCTTGAGATCTCTGGTTGGGATTCCTACGGATTGACATTCTCAGTGAAGCCGGAGTGTGAGGACCCAATCTGGAAACCCTCCTGATTTTTCCTCCACCTAGCCCCCAGACCCCAACTCCCGATTCATTGCAAGTTGTAAAGAAGCTTATACAAGGAGACTTCTGAAGATCGATGGTGTGGTTGCCTTATGTATTTGTTTGGGTTTTACCAAAAAAGGGTAAACTTGACAGAAGATCATGCCGTCCTTAGAAAATACAGCATTGCGGAGGAAGTAGACTGATATTAACAAAGCTTAATAAATAATGTACCTCATGAAATAAAAAGCAGAAAGGAATTTGAATAAAAATTTCCTGCATCTCATGCCAACGGGGAAACACCAGAATCAAGTGTTCGGTGTAACTAAAGACACCCCTTCATCCAAGAA

Ensembl | numer dostępu dla gatunku mysz

ENSMUSG00000057329

numer dostępu NCBI

NM_177410

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

mouse ... BCL2(12043) , Bcl2(12043)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Xi-Mei Wang et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 37(5), 1914-1926 (2015-11-20)
Dipeptidyl peptidase-4 (DPP-4) inhibitors have pleiotropic effects on cardiovascular protection beyond the antidiabetic property. However, it remains unknown that the impact of one DPP-4 inhibitor sitagliptin on the survival of mesenchymal stem cells (MSCs) in hypoxia and serum deprivation (H/SD)
Qingmin Wang et al.
PloS one, 9(7), e100949-e100949 (2014-07-08)
MPT64 is one of the secreted proteins from Mycobacterium tuberculosis. Little is known about its role in infection by Mycobacterium tuberculosis. In this study, we demonstrated that MPT64 could dose-dependently inhibit the apoptosis of RAW264.7 macrophages induced by PPD-BCG. Quantitative
N Bah et al.
Cell death & disease, 5, e1291-e1291 (2014-06-13)
Antimitotic agents such as microtubule inhibitors (paclitaxel) are widely used in cancer therapy while new agents blocking mitosis onset are currently in development. All these agents impose a prolonged mitotic arrest in cancer cells that relies on sustained activation of
Yang Zhou et al.
Journal of cell science, 127(Pt 20), 4494-4506 (2014-08-12)
Tubular epithelial cell apoptosis contributes to tubulointerstitial fibrosis but its regulation remains unclear. Here, in fibrotic kidney induced by unilateral ureteral obstruction (UUO), we demonstrate that miR-34a is markedly upregulated in tubulointerstitial spaces and microvesicles isolated from obstructed kidney. However
Caina Xu et al.
Small (Weinheim an der Bergstrasse, Germany), 11(34), 4321-4333 (2015-07-03)
A pulmonary codelivery system that can simultaneously deliver doxorubicin (DOX) and Bcl2 siRNA to the lungs provides a promising local treatment strategy for lung cancers. In this study, DOX is conjugated onto polyethylenimine (PEI) by using cis-aconitic anhydride (CA, a
Wyświetl wszystkie powiązane dokumenty

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej