Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Key Documents

EMU003031

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Xiap

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

CCGGGAGCAGCTATCTATCACTTGAGGTCCTGATTGCAGATCTTGTGAGTGCTCAGAAAGATAATACGGAGGATGAGTCAAGTCAAACTTCATTGCAGAAAGACATTAGTACTGAAGAGCAGCTAAGGCGCCTACAAGAGGAGAAGCTTTCCAAAATCTGTATGGATAGAAATATTGCTATCGTTTTTTTTCCTTGTGGACATCTGGCCACTTGTAAACAGTGTGCAGAAGCAGTTGACAAATGTCCCATGTGCTACACCGTCATTACGTTCAACCAAAAAATTTTTATGTCTTAGTGGGGCACCACATGTTATGTTCTTCTTGCTCTAATTGAATGTGTAATGGGAGCGAACTTTAAGTAATCCTGCATTTGCATTCCATTAGCATCCTGCTGTTTCCAAATGG

Ensembl | numer dostępu dla gatunku mysz

ENSMUSG00000025860

numer dostępu NCBI

NP_033818

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

mouse ... Xiap(11798)

Powiązane kategorie

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Anak A S S K Dharmapatni et al.
Mediators of inflammation, 2015, 564042-564042 (2015-09-09)
To investigate the effect of Embelin, an inhibitor of X-Linked Inhibitor of Apoptosis Protein (XIAP), on inflammation and bone erosion in a collagen antibody induced arthritis (CAIA) in mice. Four groups of mice (n = 6 per group) were allocated:
N Raulf et al.
British journal of cancer, 111(10), 1955-1964 (2014-10-15)
Current treatment strategies for head and neck cancer are associated with significant morbidity and up to 50% of patients relapse, highlighting the need for more specific and effective therapeutics. Tumour necrosis factor-related apoptosis-inducing ligand (TRAIL) and Smac mimetics (SMs) are
Azhar R Hussain et al.
The Journal of clinical endocrinology and metabolism, 100(7), E974-E985 (2015-05-15)
Papillary thyroid cancer (PTC) is the second most common cancer in females in Saudi Arabia. However, the pathogenesis of PTC is still not fully elucidated. To identify potential genes that play important role in progression of PTC, we studied the
Sojung Park et al.
Anticancer research, 34(7), 3557-3562 (2014-07-02)
Despite the selectivity of Tumor necrosis factor Related Apoptosis-Inducing Ligand (TRAIL) for cancer cell killing activity, breast cancer cells are resistant to TRAIL-induced apoptosis for various reasons. From a functionally-characterized small-molecule dataset, CGP74514A was identified as a TRAIL sensitizer in
Cheng-Yu Tsai et al.
Metallomics : integrated biometal science, 7(11), 1477-1487 (2015-07-25)
Mammalian cells have two influx Cu transporters that form trimers in membranes. CTR1 is the high affinity transporter that resides largely in the plasma membrane, and CTR2 is the low affinity transporter that is primarily associated with vesicular structures inside

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej