Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Kluczowe dokumenty

EMU001851

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Nkx3-1

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

CTGGCATCCATCTTTCTGGTAGCAACAGTTCTGCTGATAACTGCATATATCAGAAACTGTCTTCCCTGGGGGTCTCTGGGAAAAAGCCACAGTGGCTGATGTCAAGGAGTCGGAAGCAAGAAATGTACAGATGCAAACTGTTGGGGGTTCCCAGGGAACACTCCAATTCTTCTCTGGTGGGCAGGTGAAAGATCTGGGGCAGTGACTATTTGAAGATGTAGTCCCAGTTCCAAGTGTCCTGTAGGTGACTGCTGCCCGCTCCCCTGTTTAGAGAGAGCCAGGCAAGTTTGAGTCTTGTTTCCAGAACTTAGAATGGCTACAGATGCAATGGCTATATCGTTCCTAGGAATTCTGTTGTGGCAACTCCATCCTCTCCCATGACTGAGTATCATGGAAGGGCCAA

Ensembl | numer dostępu dla gatunku mysz

ENSMUSG00000022061

numer dostępu NCBI

NM_010921

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

mouse ... NKX3-1(18095) , Nkx3-1(18095)

Powiązane kategorie

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Nie możesz znaleźć właściwego produktu?  

Wypróbuj nasz Narzędzie selektora produktów.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Z T Gu et al.
Scientific reports, 5, 11497-11497 (2015-06-25)
In this study, We demonstrated that Bax mitochondrial translocation plays a vital role in the initiation of the mitochondrial signaling pathway upon activation by heat stress. In addition, both p53 mitochondrial translocation and Ca(2+) signal mediated MPTP opening activate Bax
Desheng Zhong et al.
Journal of cellular biochemistry, 115(9), 1624-1635 (2014-05-03)
Pan-Bcl-2 family inhibitor obatoclax has been demonstrated to be effective against various cancers, of which the mechanism of action is not fully understood. In this study, we demonstrate that obatoclax suppressed esophageal cancer cell viability with concomitant G1/G0-phase cell cycle
N Bah et al.
Cell death & disease, 5, e1291-e1291 (2014-06-13)
Antimitotic agents such as microtubule inhibitors (paclitaxel) are widely used in cancer therapy while new agents blocking mitosis onset are currently in development. All these agents impose a prolonged mitotic arrest in cancer cells that relies on sustained activation of
Xi-Liang Wang et al.
PloS one, 10(8), e0136049-e0136049 (2015-08-28)
MicroRNA (miRNA) is a kind of short non-coding RNA, involved in various cellular processes. During keratinocyte differentiation, miRNAs act as important regulators. In this study, we demonstrated by microarray assay that the expression of miR-378b significantly increased during keratinocytes differentiation.

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej