Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Key Documents

EHU184131

Sigma-Aldrich

MISSION® esiRNA

targeting human SOX2

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych


About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

GTTTGCAAAAGGGGGAAAGTAGTTTGCTGCCTCTTTAAGACTAGGACTGAGAGAAAGAAGAGGAGAGAGAAAGAAAGGGAGAGAAGTTTGAGCCCCAGGCTTAAGCCTTTCCAAAAAATAATAATAACAATCATCGGCGGCGGCAGGATCGGCCAGAGGAGGAGGGAAGCGCTTTTTTTGATCCTGATTCCAGTTTGCCTCTCTCTTTTTTTCCCCCAAATTATTCTTCGCCTGATTTTCCTCGCGGAGCCCTGCGCTCCCGACACCCCCGCCCGCCTCCCCTCCTCCTCTCCCCCCGCCCGCGGGCCCCCCAAAGTCCCGGCCGGGCCGAGGGTCGGCGGCCGCCGGCGGGCCGGGCCCGCGCACAGCGCCCGCATGTACAACATGATGGAGACGGAGCTGAA

Ensembl | numer dostępu dla gatunku człowiek

numer dostępu NCBI

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... SOX2(6657) , Sox2()

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable


Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Jiaxuan Chen et al.
Molecular carcinogenesis, 56(10), 2267-2278 (2017-05-26)
Fas signaling promotes colorectal cancer (CRC) metastasis by inducing epithelial-mesenchymal transition (EMT). The acquisition of EMT properties in turn induces stemness but the mechanism by which Fas signaling contributes to it still remains unclear. Hence, the aim of this study
Liang Tang et al.
Pathology oncology research : POR, 24(4), 907-913 (2018-04-06)
Osteosarcoma (OS) was a prevalent malignant bone tumor which threatens people's health worldwide. Wnt/β catenin signaling pathway had been proved significant in various cancers, indicating its possible function in OS as well. Sox2, a crucial member among SOX family could
Tatsuya Ishiguro et al.
Cancer research, 76(1), 150-160 (2015-12-17)
The establishment of cancer stem-like cell (CSC) culture systems may be instrumental in devising strategies to fight refractory cancers. Inhibition of the Rho kinase ROCK has been shown to favorably affect CSC spheroid cultures. In this study, we show how
Keshav Gopal et al.
Oncotarget, 7(3), 3111-3127 (2015-12-20)
We have previously identified a novel intra-tumoral dichotomy in breast cancer based on the differential responsiveness to a Sox2 reporter (SRR2), with cells responsive to SRR2 (RR) being more stem-like than unresponsive cells (RU). Here, we report that RR cells
Nicolas Chassaing et al.
Genome research, 26(4), 474-485 (2016-02-20)
Ocular developmental anomalies (ODA) such as anophthalmia/microphthalmia (AM) or anterior segment dysgenesis (ASD) have an estimated combined prevalence of 3.7 in 10,000 births. Mutations in SOX2 are the most frequent contributors to severe ODA, yet account for a minority of

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej