Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Kluczowe dokumenty

EHU159431

Sigma-Aldrich

MISSION® esiRNA

targeting human USP9X

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

Formularz

lyophilized powder

sekwencja docelowa esiRNA cDNA

TTCCTGCATCCAATGTTTACCTACAGTATATGAGAAATGGAGAGCTTCCAGCTGAACAGGCTATTCCGGTCTGTGGTTCACCACCTACAATTAATGCTGGTTTTGAATTACTTGTAGCATTAGCTGTTGGCTGTGTGAGGAATCTCAAACAAATAGTAGATTCTTTGACTGAAATGTATTACATTGGCACAGCAATAACTACTTGTGAAGCACTTACTGAGTGGGAATATCTGCCACCTGTTGGACCCCGCCCACCCAAAGGATTCGTGGGGCTGAAAAATGCCGGTGCTACTTGTTACATGAATTCTGTGATTCAGCAACTCTACATGATTCCTTCCATTAGGAACGGTATTCTTGCCATTGAAGGCACAGGTAGTGATGTAGATGATGATATGTCTGGGGATGAGAAGCA

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000124486

numer dostępu NCBI

NM_001039591

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... USP9X(8239) , USP9X(8239)

Opis ogólny

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Nie możesz znaleźć właściwego produktu?  

Wypróbuj nasz Narzędzie selektora produktów.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Wybierz jedną z najnowszych wersji:

Certyfikaty analizy (CoA)

Lot/Batch Number
XZU
ZYU
OWU
QCS
ABS

Nie widzisz odpowiedniej wersji?

Jeśli potrzebujesz konkretnej wersji, możesz wyszukać konkretny certyfikat według numeru partii lub serii.

Wyszukaj dokument COA

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Hui Peng et al.
The Journal of reproduction and development, 64(2), 173-177 (2018-02-13)
Fas-associated protein factor 1 (FAF1) is a Fas-associated protein that functions in multiple cellular processes. Previous research showed that mutations in Faf1 led to the lethality of cleavage stage embryos in a mouse model. The aim of the present study
Hua He et al.
ACS nano, 10(2), 1859-1870 (2016-01-27)
Treatment of inflammatory diseases represents one of the biggest clinical challenges. RNA interference (RNAi) against TNF-α provides a promising modality toward anti-inflammation therapy, but its therapeutic potential is greatly hampered by the by the lack of efficient siRNA delivery vehicles
Yu Xia et al.
International journal of nanomedicine, 13, 143-159 (2018-01-11)
Human homeobox protein (Nanog) is highly expressed in most cancer cells and has gradually emerged as an excellent target in cancer therapy, owing to its regulation of cancer cell proliferation, metastasis and apoptosis. In this study, we prepared tumor-targeting functionalized
Gang Chen et al.
ACS nano, 12(7), 6620-6636 (2018-07-10)
Metastatic breast cancer is a major cause of cancer-related female mortality worldwide. The signal transducer and activator of transcription 3 (STAT3) and the chemokine receptor CXCR4 are involved in the metastatic spread of breast cancer. The goal of this study
Jesse L Cox et al.
Cancer biology & therapy, 15(8), 1042-1052 (2014-05-21)
Pancreatic ductal adenocarcinoma (PDAC) is one of the most aggressive and deadly malignancies. Recently, the deubiquitinating protease USP9X has been shown to behave as an oncogene in a number of neoplasms, including those of breast, brain, colon, esophagus and lung
Wyświetl wszystkie powiązane dokumenty

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej