Wszystkie zdjęcia(1)

Key Documents

EHU157961

MISSION^® esiRNA

Name: MISSION<SUP>®</SUP> esiRNA
Brand: SIGMA

targeting human CD74

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych

Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:

41105324

NACRES:

NA.51

opis

linia produktu

MISSION^®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

ACACAGGCTTTTCCATCCTGGTGACTCTGCTCCTCGCTGGCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAACTGACAGTCACCTCCCAGAACCTGCAGCTGGAGAACCTGCGCATGAAGCTTCCCAAGCCTCCCAAGCCTGTGAGCAAGATGCGCATGGCCACCCCGCTGCTGATGCAGGCGCTGCCCATGGGAGCCCTGCCCCAGGGGCCCATGCAGAATGCCACCAAGTATGGCAACATGACAGAGGACCATGTGATGCACCTGCTCCAGAATGCTGACCCCCTGAAGGTGTACCCGCCACTGAAGGGGAGCTTCCCGGAGAACCTGAGACACCTTAAGAACACCATGGAGACCATAGACTGGAAGGTCTTTGAGAGCTGGATGC

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000019582

numer dostępu NCBI

NM_001025158

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... CD74(972) , CD74(972)

Powiązane kategorie

MISSION® esiRNA

Oligos, qPCR Probes & Peptides

Opis ogólny

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Targetted inhibition of CD74 attenuates adipose COX-2-MIF-mediated M1 macrophage polarization and retards obesity-related adipose tissue inflammation and insulin resistance.

Pei-Chi Chan et al.

Clinical science (London, England : 1979), 132(14), 1581-1596 (2018-05-19)

Adipose tissue (AT) inflammation is crucial to the development of obesity-associated insulin resistance. Our aim was to investigate the contribution of cyclooxygenase-2 (COX-2)/macrophage migration inhibitory factor (MIF)-mediated cross-talk between hypertrophic adipocytes and macrophages to the etiology of AT inflammation and

Expression of CD74 in bladder cancer and its suppression in association with cancer proliferation, invasion and angiogenesis in HT-1376 cells.

Jun-Wei Gai et al.

Oncology letters, 15(5), 7631-7638 (2018-05-08)

The aim of the present study was to investigate the expression and potential roles of CD74 in human urothelial cell carcinoma of the bladder (UCB) in vitro and in vivo. CD74 and macrophage migration inhibitory factor (MIF) were located and

The Smad3-miR-29b/miR-29c axis mediates the protective effect of macrophage migration inhibitory factor against cardiac fibrosis.

Jing-Nan Liang et al.

Biochimica et biophysica acta. Molecular basis of disease, 1865(9), 2441-2450 (2019-06-09)

Although macrophage migration inhibitory factor (MIF) is known to have antioxidant property, the role of MIF in cardiac fibrosis has not been well understood. We found that MIF was markedly increased in angiotension II (Ang-II)-infused mouse myocardium. Myocardial function was

Cadherin-11 coordinates cellular migration and extracellular matrix remodeling during aortic valve maturation.

Caitlin J Bowen et al.

Developmental biology, 407(1), 145-157 (2015-07-19)

Proper remodeling of the endocardial cushions into thin fibrous valves is essential for gestational progression and long-term function. This process involves dynamic interactions between resident cells and their local environment, much of which is not understood. In this study, we

Macrophage migration inhibitory factor promotes expression of GLUT4 glucose transporter through MEF2 and Zac1 in cardiomyocytes.

Yeyou Liang et al.

Metabolism: clinical and experimental, 64(12), 1682-1693 (2015-10-13)

Evidence shows that both macrophage migration inhibitory factor (MIF) and GLUT4 glucose transporter are involved in diabetic cardiomyopathy (DCM), but it remains largely unknown whether and how MIF regulates GLUT4 expression in cardiomyocytes. The present study aims to investigate the

Wyświetl wszystkie powiązane dokumenty

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej