Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Kluczowe dokumenty

EHU156661

Sigma-Aldrich

MISSION® esiRNA

targeting human NFE2

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych


About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

linia produktu

MISSION®

Formularz

lyophilized powder

sekwencja docelowa esiRNA cDNA

AATGCTCCAAGTGAGCCATCATTTGAGCCCCAAGCCCCAGCTCCATACCTTGGACCTCCACCACCCACAACTTACTGCCCCTGCTCAATCCACCCAGATTCTGGCTTCCCACTTCCTCCACCACCTTATGAGCTCCCAGCATCCACATCCCATGTCCCAGATCCCCCATACTCCTATGGCAACATGGCCATACCAGTCTCCAAGCCACTGAGCCTCTCAGGCCTGCTCAGTGAGCCGCTCCAAGACCCCTTAGCCCTCCTGGACATTGGGCTGCCAGCAGGGCCACCTAAGCCCCAAGAAGACCCAGAATCCGACTCAGGATTATCCCTCAACTATAGCGATGCTGAATCTCTTGAGCTGGAGGGGACAGAGGCTGGTCGGCGGCGCAGCGAATATGTAGAGATGTACCCAGTGGAGTACCCCTACTCACTCATGCCCAACTCC

Ensembl | numer dostępu dla gatunku człowiek

numer dostępu NCBI

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

Opis ogólny

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Nie możesz znaleźć właściwego produktu?  

Wypróbuj nasz Narzędzie selektora produktów.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable


Wybierz jedną z najnowszych wersji:

Certyfikaty analizy (CoA)

Lot/Batch Number

Nie widzisz odpowiedniej wersji?

Jeśli potrzebujesz konkretnej wersji, możesz wyszukać konkretny certyfikat według numeru partii lub serii.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Shunying Jin et al.
Life sciences, 254, 117783-117783 (2020-05-16)
This study aimed to examine the anti-fibrotic role of Nuclear Factor-Erythroid derived 2 (NF-E2) in human renal tubule (HK-11) cells and in type 1 and type 2 diabetic (T1D, T2D) mouse kidneys. Anti-fibrotic effects of NF-E2 were examined in transforming
Haijin Chen et al.
Molecular medicine reports, 10(2), 1129-1135 (2014-06-11)
Colon cancer is a common type of malignancy in the digestive system. The aim of the present study was to investigate the role of S-phase kinase-associated protein 2 (Skp2) in colon carcinoma and to identify whether depletion of Skp2 by Skp2‑RNA interference
Ming Qi et al.
Molecular medicine reports, 11(5), 3934-3940 (2015-01-13)
In order to determine the protein expression of S‑phase kinase‑associated protein 2 (Skp2) and p27kip1, and to evaluate their possible prognostic values in malignant liver cancer, tissue samples from 50 patients and 40 controls were assessed and analyzed by immunohistochemistry
Zhe Sha et al.
The Journal of cell biology, 217(5), 1757-1776 (2018-03-15)
Proteasome inhibitors are used as research tools and to treat multiple myeloma, and proteasome activity is diminished in several neurodegenerative diseases. We therefore studied how cells compensate for proteasome inhibition. In 4 h, proteasome inhibitor treatment caused dramatic and selective

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej