Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Kluczowe dokumenty

EHU155611

Sigma-Aldrich

MISSION® esiRNA

targeting human KDR

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

Formularz

lyophilized powder

sekwencja docelowa esiRNA cDNA

AGCGATGGCCTCTTCTGTAAGACACTCACAATTCCAAAAGTGATCGGAAATGACACTGGAGCCTACAAGTGCTTCTACCGGGAAACTGACTTGGCCTCGGTCATTTATGTCTATGTTCAAGATTACAGATCTCCATTTATTGCTTCTGTTAGTGACCAACATGGAGTCGTGTACATTACTGAGAACAAAAACAAAACTGTGGTGATTCCATGTCTCGGGTCCATTTCAAATCTCAACGTGTCACTTTGTGCAAGATACCCAGAAAAGAGATTTGTTCCTGATGGTAACAGAATTTCCTGGGACAGCAAGAAGGGCTTTACTATTCCCAGCTACATGATCAGCTATGCTGGCATGGTCTTCTGTGAAGCAAAAATTAATGATGAAAGTTACCAGTCTATTATGTACATAGTTGTCGTTGTAGGGTATAGGATTTATGATGTGGTTCTGAGTCCGTCTCATGGAA

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000128052

numer dostępu NCBI

NM_002253

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... KDR(3791) , KDR(3791)

Opis ogólny

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Nie możesz znaleźć właściwego produktu?  

Wypróbuj nasz Narzędzie selektora produktów.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Wybierz jedną z najnowszych wersji:

Certyfikaty analizy (CoA)

Lot/Batch Number
ACNV
JUU
QCS
IBS
KAS

Nie widzisz odpowiedniej wersji?

Jeśli potrzebujesz konkretnej wersji, możesz wyszukać konkretny certyfikat według numeru partii lub serii.

Wyszukaj dokument COA

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Chao Ji et al.
Oncotarget, 7(51), 84748-84757 (2016-10-08)
Ultra Violet (UV) radiation induces reactive oxygen species (ROS) production, DNA oxidation and single strand breaks (SSBs), which will eventually lead to skin cell damages or even skin cancer. Here, we tested the potential activity of gremlin, a novel vascular
W-Z Hou et al.
European review for medical and pharmacological sciences, 21(5), 1080-1087 (2017-03-25)
Cerebral aneurysm is a common vascular disease with high morbidity and mortality. Vascular smooth muscle deletion or dysplasia is an important reason for the development of cerebral aneurysm. MiRNAs participate in a variety of biological functions through inhibiting target gene
Evan Bailey et al.
The American journal of pathology, 187(1), 25-32 (2016-11-16)
Vascular endothelial growth factor (VEGF)-D is capable of inducing angiogenesis and lymphangiogenesis through signaling via VEGF receptor (VEGFR)-2 and VEGFR-3, respectively. Mutations in the FIGF (c-fos-induced growth factor) gene encoding VEGF-D have not been reported previously. We describe a young
Lilian Saryeddine et al.
PloS one, 11(11), e0165876-e0165876 (2016-11-03)
EGFR and VEGFR pathways play major roles in solid tumor growth and progression, however, little is known about these pathways in haematological tumors. This study investigated the crosstalk between EGFR and VEGFR2 signaling in two hematological in vitro models: THP1
Lin-Bin Zhou et al.
International journal of ophthalmology, 13(7), 1039-1045 (2020-07-21)
To identify proangiogenic factors engaged in neovascular age-related macular degeneration (AMD) except vascular endothelial growth factor (VEGF) from human retinal pigment epithelial (hRPE) cells and investigate the underlying mechanisms. VEGF receptor 2 (VEGFR2) in ARPE-19 cells was depleted by siRNA
Wyświetl wszystkie powiązane dokumenty

Protokoły

Coronavirus qPCR Design Case Study & Related Products to Support SARS-CoV-2 Research

Coronavirus qPCR Primer and probe sets for the detection of SARS-CoV-2 (Corona Virus), with additional real-time RT-PCR, RT-qPCR and supporting reagents available.

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej