Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Kluczowe dokumenty

EHU155151

Sigma-Aldrich

MISSION® esiRNA

targeting human EP300

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych


About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

linia produktu

MISSION®

Formularz

lyophilized powder

sekwencja docelowa esiRNA cDNA

ATACCGAACCAAAGCCCTCTTTGCCTTTGAAGAAATTGATGGTGTTGACCTGTGCTTCTTTGGCATGCATGTTCAAGAGTATGGCTCTGACTGCCCTCCACCCAACCAGAGGAGAGTATACATATCTTACCTCGATAGTGTTCATTTCTTCCGTCCTAAATGCTTGAGGACTGCAGTCTATCATGAAATCCTAATTGGATATTTAGAATATGTCAAGAAATTAGGTTACACAACAGGGCATATTTGGGCATGTCCACCAAGTGAGGGAGATGATTATATCTTCCATTGCCATCCTCCTGACCAGAAGATACCCAAGCCCAAGCGACTGCAGGAATGGTACAAAAAAATGCTTGACAAGGCTGTATCAGAGCGTATTGTCCATGACTACAAGGATATTTTTAAACAAGCTACTGAAGATAGATTAACAAGTGCAAAGGAATTGCCTTATTTCGAGGGTGATTTCTGGCCCAATGTTCTG

Ensembl | numer dostępu dla gatunku człowiek

numer dostępu NCBI

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

Opis ogólny

MISSION esiRNA to siRNA przygotowane z użyciem endorybonukleazy. Są one heterogeniczną mieszaniną siRNA, które celują w tę samą sekwencję mRNA. Te wielokrotne wyzwalacze wyciszania prowadzą do wysoce specyficznego i skutecznego wyciszania genów.

Aby uzyskać dodatkowe informacje, a także zapoznać się ze wszystkimi dostępnymi opcjami esiRNA, odwiedź SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable


Wybierz jedną z najnowszych wersji:

Certyfikaty analizy (CoA)

Lot/Batch Number

Nie widzisz odpowiedniej wersji?

Jeśli potrzebujesz konkretnej wersji, możesz wyszukać konkretny certyfikat według numeru partii lub serii.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Jia Tao et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 106, 1727-1733 (2018-08-19)
Pulmonary fibrosis is strongly correlated with inflammation factors, cytokine, and collagen secretion, whereby discoidin domain receptor 1 (DDR1) signaling plays an important role. EP300 is defined as an acetyltransferase that can acetylate histone and has been broadly studied in several
Mizuo Ando et al.
Nature communications, 10(1), 2188-2188 (2019-05-18)
Although promoter-associated CpG islands have been established as targets of DNA methylation changes in cancer, previous studies suggest that epigenetic dysregulation outside the promoter region may be more closely associated with transcriptional changes. Here we examine DNA methylation, chromatin marks
Alexander Ring et al.
BMC cancer, 20(1), 1076-1076 (2020-11-11)
Triple negative breast cancer (TNBC) is an aggressive breast cancer subtype with basal features, lacking the expression of receptors targeted successfully in other breast cancer subtypes. Treatment response to adjuvant and neoadjuvant chemotherapy is often short-lived and metastatic spread occurs
Karen Dendoncker et al.
Proceedings of the National Academy of Sciences of the United States of America, 116(26), 12942-12951 (2019-06-12)
Glucocorticoid resistance (GCR) is defined as an unresponsiveness to the therapeutic effects, including the antiinflammatory ones of glucocorticoids (GCs) and their receptor, the glucocorticoid receptor (GR). It is a problem in the management of inflammatory diseases and can be congenital
Alejandro Ropolo et al.
Frontiers in endocrinology, 11, 411-411 (2020-07-14)
Autophagy is an evolutionarily preserved degradation process of cytoplasmic cellular constituents, which participates in cell response to disease. We previously characterized VMP1 (Vacuole Membrane Protein 1) as an essential autophagy related protein that mediates autophagy in pancreatic diseases. We also

Global Trade Item Number

SKUGTIN
EHU155151-20UG4061831367041
EHU155151-50UG4061831376418

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej