Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Kluczowe dokumenty

EHU153561

Sigma-Aldrich

MISSION® esiRNA

targeting human COL1A1

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych


About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

CTCCTGGCAAAGATGGACTCAACGGTCTCCCTGGCCCCATTGGGCCCCCTGGTCCTCGCGGTCGCACTGGTGATGCTGGTCCTGTTGGTCCCCCCGGCCCTCCTGGACCTCCTGGTCCCCCTGGTCCTCCCAGCGCTGGTTTCGACTTCAGCTTCCTGCCCCAGCCACCTCAAGAGAAGGCTCACGATGGTGGCCGCTACTACCGGGCTGATGATGCCAATGTGGTTCGTGACCGTGACCTCGAGGTGGACACCACCCTCAAGAGCCTGAGCCAGCAGATCGAGAACATCCGGAGCCCAGAGGGCAGCCGCAAGAACCCCGCCCGCACCTGCCGTGACCTCAAGATGTGCCACTCTGACTGGAAGAGTGGAGAGTACTGGATTGACCCCAACCAAGGCTGCAACCTGGATGCCATCAAAGTCTTCTGCAACATGGAGACTGGTGAGACCTGCGTGTACCCCACTCAGCCCAGTGTGGCCCAGAAGAACTGGTACATCAGCAAGAACCCCAAGGACAAGAGGCATGTCTGGTTCGGCGAGAGCATGACCGATGGATT

Ensembl | numer dostępu dla gatunku człowiek

numer dostępu NCBI

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

Opis ogólny

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Nie możesz znaleźć właściwego produktu?  

Wypróbuj nasz Narzędzie selektora produktów.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable


Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Jing Liu et al.
Discovery medicine, 25(139), 211-223 (2018-06-16)
Extracellular matrix (ECM) is an important component of tumor microenvironment and plays critical roles in cancer development and metastasis, in which collagen is the major structural protein. Collagen type I alpha 1 (COL1A1) is reportedly associated with the development of
Zheying Zhang et al.
International journal of oncology, 53(5), 1869-1880 (2018-08-23)
Colorectal cancer (CRC) treatment primarily relies on chemotherapy along with surgery, radiotherapy and, more recently, targeted therapy at the late stages. However, chemotherapeutic drugs have high cytotoxicity, and the similarity between the effects of these drugs on cancerous and healthy
Gennaro Di Maro et al.
The Journal of clinical endocrinology and metabolism, 99(9), E1617-E1626 (2014-05-23)
Anaplastic thyroid carcinoma (ATC) is one of the most aggressive human tumors. Twist1 is a basic helix-loop-helix transcription factor involved in cancer development and progression. We showed that Twist1 affects thyroid cancer cell survival and motility. We aimed to identify
Catherine M Willis et al.
PloS one, 9(8), e103966-e103966 (2014-08-05)
Expression of the glycosaminoglycan chondroitin sulfate-E (CS-E) is misregulated in many human cancers, including breast cancer. Cell-surface associated CS-E has been shown to have pro-tumorigenic functions, and pharmacological treatment with exogenous CS-E has been proposed to interfere with tumor progression

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej