Wszystkie zdjęcia(1)

Key Documents

EHU141291

MISSION^® esiRNA

Name: MISSION<SUP>®</SUP> esiRNA
Brand: SIGMA

targeting human ABL1

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych

Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:

41105324

NACRES:

NA.51

opis

linia produktu

MISSION^®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

TGGCAAGCTCTACGTCTCCTCCGAGAGCCGCTTCAACACCCTGGCCGAGTTGGTTCATCATCATTCAACGGTGGCCGACGGGCTCATCACCACGCTCCATTATCCAGCCCCAAAGCGCAACAAGCCCACTGTCTATGGTGTGTCCCCCAACTACGACAAGTGGGAGATGGAACGCACGGACATCACCATGAAGCACAAGCTGGGCGGGGGCCAGTACGGGGAGGTGTACGAGGGCGTGTGGAAGAAATACAGCCTGACGGTGGCCGTGAAGACCTTGAAGGAGGACACCATGGAGGTGGAAGAGTTCTTGAAAGAAGCTGCAGTCATGAAAGAGATCAAACACCCTAACCTGGTGCAGCTCCTTGGGGTCTGCACCCGGGAGCCCCCGTTCTATATCATCACTGAGTTCATGACCTACGGGAACCTCCT

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000097007

numer dostępu NCBI

NM_005157

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... ABL1(25) , ABL1(25)

Powiązane kategorie

MISSION® esiRNA

Oligos, qPCR Probes & Peptides

Opis ogólny

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Remant Kc et al.

Stem cells and development, 28(11), 734-744 (2018-12-27)

Nonviral gene therapy with specific short interfering RNAs (siRNAs) against BCR-Abl can be an alternative and/or supportive therapy of chronic myeloid leukemia (CML) with tyrosine kinase inhibitors (TKIs), given the often observed resistance to TKIs in clinical setting. In this

The Significant Role of c-Abl Kinase in Barrier Altering Agonists-mediated Cytoskeletal Biomechanics.

X Wang et al.

Scientific reports, 8(1), 1002-1002 (2018-01-19)

Exploration of human pulmonary artery endothelial cell (EC) as a prototypical biomechanical system has important pathophysiologic relevance because this cell type plays a key role in the development of a wide variety of clinical conditions. The complex hierarchical organization ranging

Targeting ABL1 or ARG Tyrosine Kinases to Restrict HIV-1 Infection in Primary CD4+ T-Cells or in Humanized NSG Mice.

Stephen D S McCarthy et al.

Journal of acquired immune deficiency syndromes (1999), 82(4), 407-415 (2019-10-29)

Previous studies support dasatinib as a potent inhibitor of HIV-1 replication. However, a functional distinction between 2 kinase targets of the drug, ABL1 and ARG, has not been assessed. We used primary CD4 T-cells, CD8-depleted peripheral blood mononuclear cells (PBMCs)

Cholesterol grafted cationic lipopolymers: Potential siRNA carriers for selective chronic myeloid leukemia therapy.

K C Remant et al.

Journal of biomedical materials research. Part A, 108(3), 565-580 (2019-11-13)

Synthetic siRNA technology has emerged as a promising approach for molecular therapy of cancer but, despite its potential for post-transcriptional gene silencing, there is an urgent need to develop efficient delivery systems particularly for difficult-to-transfect, anchorage-independent cells. In this study

Arg mediates LPS-induced disruption of the pulmonary endothelial barrier.

Alicia N Rizzo et al.

Vascular pharmacology, 128-129, 106677-106677 (2020-04-03)

Acute Respiratory Distress Syndrome (ARDS) is a devastating disease process that involves dysregulated inflammation and decreased alveolar-capillary barrier function. Despite increased understanding of the pathophysiology, no effective targeted therapies exist to treat ARDS. Recent preclinical studies suggest that the multi-tyrosine

Wyświetl wszystkie powiązane dokumenty

Produkty

esiRNA Knockdown Efficiency Tested by Western Blotting

Quantitative and qualitative western blotting to validate knockdown by esiRNA. Sigma-Aldrich.com

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej