Przejdź do zawartości
Merck
Wszystkie zdjęcia(2)

Kluczowe dokumenty

EHU135281

Sigma-Aldrich

MISSION® esiRNA

targeting human BCL2

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych


About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

linia produktu

MISSION®

Formularz

lyophilized powder

sekwencja docelowa esiRNA cDNA

CGGCCTCTGTTTGATTTCTCCTGGCTGTCTCTGAAGACTCTGCTCAGTTTGGCCCTGGTGGGAGCTTGCATCACCCTGGGTGCCTATCTGGGCCACAAGTGAAGTCAACATGCCTGCCCCAAACAAATATGCAAAAGGTTCACTAAAGCAGTAGAAATAATATGCATTGTCAGTGATGTACCATGAAACAAAGCTGCAGGCTGTTTAAGAAAAAATAACACACATATAAACATCACACACACAGACAGACACACACACACACAACAATTAACAGTCTTCAGGCAAAACGTCGAATCAGCTATTTACTGCCAAAGGGAAATATCATTTATTTTTTACATTATTAAGAAAAAAAGATTTATTTATTTAAGACAGTCCCATCAAAACTCCTGTCTTTGGAAATCCGACCACTAATTGCCAAGCACC

Ensembl | numer dostępu dla gatunku człowiek

numer dostępu NCBI

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

Opis ogólny

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable


Wybierz jedną z najnowszych wersji:

Certyfikaty analizy (CoA)

Lot/Batch Number

Nie widzisz odpowiedniej wersji?

Jeśli potrzebujesz konkretnej wersji, możesz wyszukać konkretny certyfikat według numeru partii lub serii.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Ya'nan Yang et al.
OncoTargets and therapy, 12, 897-906 (2019-02-19)
Peritoneal metastasis is the most common pathway for the spread of ovarian cancer. Ovarian cancer cells in ascites prefer to aggregate into the more chemoresistant multicellular spheroids (MCSs), leading to treatment failure and disease recurrence. We previously established a suspension
Jianxu Zhang et al.
International journal of nanomedicine, 12, 4721-4732 (2017-07-26)
Herein, DNA duplex was constructed through the hybridization of adenosine triphosphate (ATP)-responsive aptamer and its cDNA in which GC-rich motif could be used to load doxorubicin (DOX), and then, cationic polymer PEI25K was used as a carrier to simultaneously condense
Kangcheng Zhao et al.
Gene, 628, 259-266 (2017-07-19)
Accumulating evidence indicates that microRNAs can regulate the apoptosis of various cells. Apoptosis of nucleus pulposus cells plays an important role in the progression of intervertebral disc degeneration. The aim of this study is to investigate whether microRNA-143 (miRNA-143) is
Tian-Quan Yang et al.
OncoTargets and therapy, 10, 4305-4313 (2017-09-19)
Glioma is one of the most common types of adult primary brain tumors, and the underlying molecular mechanisms still remain unclear. Nuclear factor-kappa B1 (NF-κB1) is involved in a variety of malignancies and is widely expressed in malignant tumors. However
Gui-Yun Xu et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 92, 95-107 (2017-05-23)
Gastric cancer still presents a significant problem for public health worldwide. Troxerutin (TXN), a flavonoid present in tea, coffee, cereal grains, and a variety of fruits and vegetables, exhibits various pharmacological and biological activities in vitro and in vivo. We

Produkty

Quantitative and qualitative western blotting to validate knockdown by esiRNA. Sigma-Aldrich.com

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej