Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Key Documents

EHU100971

Sigma-Aldrich

MISSION® esiRNA

targeting human PRC1

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych


About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

GGACCAGCGGTTACAAAGAACTGAGGTGGTAAAGAAGCATATCAAGGAACTCCTGGATATGATGATTGCTGAAGAGGAAAGCCTGAAGGAAAGACTCATCAAAAGCATATCCGTCTGTCAGAAAGAGCTGAACACTCTGTGCAGCGAGTTACATGTTGAGCCATTTCAGGAAGAAGGAGAGACGACCATCTTGCAACTAGAAAAAGATTTGCGCACCCAAGTGGAATTGATGCGAAAACAG

Ensembl | numer dostępu dla gatunku człowiek

numer dostępu NCBI

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

Opis ogólny

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable


Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Tianxiang Xu et al.
Cancer cell international, 20(1), 528-528 (2020-12-10)
Protein regulator of cytokinesis 1 (PRC1) has been reported to play important role in the pathogenesis of various cancers. However, its role in colon cancer has not been studied. Here, we aimed to investigate the biological functions and potential mechanism
Bin Zhang et al.
Journal of cellular and molecular medicine, 21(7), 1329-1341 (2017-02-13)
Gastric carcinoma is one of the most common malignancies worldwide and the second most frequent cause of cancer-related death in China. Protein regulator of cytokinesis 1 (PRC1) is involved in cytokinesis and plays key roles in microtubule organization in eukaryotes.
Melissa C Pamula et al.
The Journal of cell biology, 218(8), 2529-2544 (2019-06-30)
In the spindle midzone, microtubules from opposite half-spindles form bundles between segregating chromosomes. Microtubule bundles can either push or restrict chromosome movement during anaphase in different cellular contexts, but how these activities are achieved remains poorly understood. Here, we use

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej