Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Kluczowe dokumenty

EHU099881

Sigma-Aldrich

MISSION® esiRNA

targeting human FN1

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

Formularz

lyophilized powder

sekwencja docelowa esiRNA cDNA

ACACCTTCGGGGGAAATAATTCCTGTGAATATTCTTTTTCAATTCAGCAAACATTTGAAAATCTATGATGTGCAAGTCTAATTGTTGATTTCAGTACAAGATTTTCTAAATCAGTTGCTACAAAAACTGATTGGTTTTTGTCACTTCATCTCTTCACTAATGGAGATAGCTTTACACTTTCTGCTTTAATAGATTTAAGTGGACCCCAATATTTATTAAAATTGCTAGTTTACCGTTCAGAAGTATAATAGAAATAATCTTTAGTTGCTCTTTTCTAACCATTGTAATTCTTCCCTTCTTCCCTCCACCTTTC

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000115414

numer dostępu NCBI

NM_212474

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... FN1(2335) , FN1(2335)

Powiązane kategorie

Opis ogólny

MISSION esiRNA to siRNA przygotowane z użyciem endorybonukleazy. Są one heterogeniczną mieszaniną siRNA, które celują w tę samą sekwencję mRNA. Te wielokrotne wyzwalacze wyciszania prowadzą do wysoce specyficznego i skutecznego wyciszania genów.

Aby uzyskać dodatkowe informacje, a także zapoznać się ze wszystkimi dostępnymi opcjami esiRNA, odwiedź SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Wybierz jedną z najnowszych wersji:

Certyfikaty analizy (CoA)

Lot/Batch Number
UTU
WRU
UPU
QCS
KXT

Nie widzisz odpowiedniej wersji?

Jeśli potrzebujesz konkretnej wersji, możesz wyszukać konkretny certyfikat według numeru partii lub serii.

Wyszukaj dokument COA

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Seth P Zimmerman et al.
Journal of cell science, 130(18), 2971-2983 (2017-07-30)
Rho GTPase family members are known regulators of directed migration and therefore play key roles in processes including development, the immune response and cancer metastasis. However, their individual contributions to these processes are complex. Here, we modify the activity of
Changgeng Xu et al.
Molecular medicine reports, 13(1), 901-908 (2015-12-10)
Lefty is a member of the transforming growth factor (TGF) β superfamily, which is implicated in left‑right patterning during embryogenesis. Previous studies revealed that lefty attenuates the epithelial‑mesenchymal transition in tubular epithelial cells. In the present study, the protective effect
Najla El-Hachem et al.
Cell death and differentiation, 25(11), 2010-2022 (2018-03-09)
HACE1 is an E3 ubiquitin ligase described as a tumour suppressor because HACE1-knockout mice develop multi-organ, late-onset cancers and because HACE1 expression is lost in several neoplasms, such as Wilms' tumours and colorectal cancer. However, a search of public databases
Wenzhong Yi et al.
Oncology reports, 36(6), 3145-3153 (2016-10-18)
Fibronectin is a glycoprotein of the extracellular matrix, and regulates the processes of self-renewal and cell cycle progression. This study aimed to investigate fibronectin expression in colorectal cancer (CRC) and elucidate the effects of fibronectin on CRC by using a
Fumiaki Sato et al.
Biological & pharmaceutical bulletin, 40(10), 1646-1653 (2017-10-03)
The cross-linking of elastin by lysyl oxidase (LOX) family members is essential for the integrity and elasticity of elastic fibers, which play an important role in the characteristic resilience of various tissues. However, the temporal sequence of oxidation by LOX
Wyświetl wszystkie powiązane dokumenty

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej