Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Kluczowe dokumenty

EHU099351

Sigma-Aldrich

MISSION® esiRNA

targeting human CDK1

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

CCATGGGGATTCAGAAATTGATCAACTCTTCAGGATTTTCAGAGCTTTGGGCACTCCCAATAATGAAGTGTGGCCAGAAGTGGAATCTTTACAGGACTATAAGAATACATTTCCCAAATGGAAACCAGGAAGCCTAGCATCCCATGTCAAAAACTTGGATGAAAATGGCTTGGATTTGCTCTCGAAAATGTTAATCTATGATCCAGCCAAACGAATTTCTGGCAAAATGG

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000170312

numer dostępu NCBI

NM_033379

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... CDK1(983) , CDC2(983)

Opis ogólny

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Nie możesz znaleźć właściwego produktu?  

Wypróbuj nasz Narzędzie selektora produktów.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Masanori Saito et al.
Scientific reports, 6, 20622-20622 (2016-02-11)
Skeletal development is tightly regulated through the processes of chondrocyte proliferation and differentiation. Although the involvement of transcription and growth factors on the regulation of skeletal development has been extensively studied, the role of cell cycle regulatory proteins in this
Gabriel Kollarovic et al.
Aging, 8(1), 158-177 (2016-02-03)
Excessive DNA damage can induce an irreversible cell cycle arrest, called senescence, which is generally perceived as an important tumour-suppressor mechanism. However, it is unclear how cells decide whether to senesce or not after DNA damage. By combining experimental data
Chen Sai et al.
International heart journal, 60(2), 374-383 (2019-02-13)
Atrial fibrillation has caused severe burden for people worldwide. Differentiation of fibroblasts into myofibroblasts, and consequent progress in atrial structural remodeling have been considered the basis for persistent atrial fibrillation, yet little is known about the molecular mechanisms underlying the
Tatyana S Nekova et al.
Cell cycle (Georgetown, Tex.), 15(23), 3203-3209 (2016-11-11)
Small molecule inhibitors targeting CDK1/CDK2 have been clinically proven effective against a variety of tumors, albeit at the cost of profound off target toxicities. To separate potential therapeutic from toxic effects, we selectively knocked down CDK1 or CDK2 in p53
Maria Sokolova et al.
Cell cycle (Georgetown, Tex.), 16(2), 189-199 (2016-12-09)
To identify cell cycle regulators that enable cancer cells to replicate DNA and divide in an unrestricted manner, we performed a parallel genome-wide RNAi screen in normal and cancer cell lines. In addition to many shared regulators, we found that
Wyświetl wszystkie powiązane dokumenty

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej