Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Kluczowe dokumenty

EHU091731

Sigma-Aldrich

MISSION® esiRNA

targeting human MET

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych


About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

linia produktu

MISSION®

Formularz

lyophilized powder

sekwencja docelowa esiRNA cDNA

CCACATTGACCTCAGTGCTCTAAATCCAGAGCTGGTCCAGGCAGTGCAGCATGTAGTGATTGGGCCCAGTAGCCTGATTGTGCATTTCAATGAAGTCATAGGAAGAGGGCATTTTGGTTGTGTATATCATGGGACTTTGTTGGACAATGATGGCAAGAAAATTCACTGTGCTGTGAAATCCTTGAACAGAATCACTGACATAGGAGAAGTTTCCCAATTTCTGACCGAGGGAATCATCATGAAAGATTTTAGTCATCCCAATGTCCTCTCGCTCCTGGGAATCTGCCTGCGAAGTGAAGGGTCTCCGCTGGTGGTCCTACCATACATGAAACATGGAGATCTTCGAAATTTCATTCGAAATGAGACTCATAATCCAACTGTAAAAGATCTTATTGGCTTTGGTCTTCAAGTAGCCAAAGGCATGA

Ensembl | numer dostępu dla gatunku człowiek

numer dostępu NCBI

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

Opis ogólny

MISSION esiRNA to siRNA przygotowane z użyciem endorybonukleazy. Są one heterogeniczną mieszaniną siRNA, które celują w tę samą sekwencję mRNA. Te wielokrotne wyzwalacze wyciszania prowadzą do wysoce specyficznego i skutecznego wyciszania genów.

Aby uzyskać dodatkowe informacje, a także zapoznać się ze wszystkimi dostępnymi opcjami esiRNA, odwiedź SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable


Wybierz jedną z najnowszych wersji:

Certyfikaty analizy (CoA)

Lot/Batch Number

Nie widzisz odpowiedniej wersji?

Jeśli potrzebujesz konkretnej wersji, możesz wyszukać konkretny certyfikat według numeru partii lub serii.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Demin Jiao et al.
Journal of cellular and molecular medicine, 22(7), 3526-3536 (2018-04-18)
Hepatocyte growth factor (HGF) overexpression is an important mechanism in acquired epidermal growth factor receptor (EGFR) kinase inhibitor gefitinib resistance in lung cancers with EGFR activating mutations. MiR-1-3p and miR-206 act as suppressors in lung cancer proliferation and metastasis. However
J van de Kamp et al.
Journal of tissue engineering and regenerative medicine, 11(11), 2988-2998 (2016-09-20)
Mesenchymal stem cells (MSC) are precursor cells of mesodermal tissue and, because of their trophic phenotype, they are known to play beneficial roles in wound healing. In addition, various tissue engineering strategies are based on MSC/biomaterial constructs. As the isolation
Jie Zhu et al.
Oncotarget, 8(65), 108665-108675 (2018-01-10)
Tumor necrosis factor-related apoptosis inducing ligand (TRAIL) induces apoptosis in malignant cells, but not in normal cells. As papillary thyroid carcinoma cells broadly expressed TRAIL receptors (death receptor 4 and death receptor 5) on their surface, TRAIL is considered as
Jun Liu et al.
Journal of experimental & clinical cancer research : CR, 34, 35-35 (2015-05-01)
Gastric cancer (GC) remains one of the most common types of malignant cancer, and the molecular mechanism underlying its metastasis is still largely unclear. MicroRNAs have emerged as important regulators of metastasis because of their ability to act on multiple
Yan Zhao et al.
International journal of clinical and experimental pathology, 8(4), 3719-3726 (2015-06-23)
Cyclooxygenase2 (Cox-2) is well known for glioma growth through up-regulation of prostaglandin E2 (PGE2) levels. MET, a hepatocyte growth factor (HGF) receptor, is also frequently high expressed in glioma, which promotes glioma growth and invasion. Here, we demonstrate that HGF/MET

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej