Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Kluczowe dokumenty

EHU082441

Sigma-Aldrich

MISSION® esiRNA

targeting human DAB2

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych


About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

CTGGGACTTTGAGTGCCTTTGCCAGTTATTTCAACAGCAAGGTTGGCATTCCTCAGGAGAATGCAGACCATGATGACTTTGATGCTAATCAACTATTGAACAAGATCAATGAACCACCAAAGCCAGCTCCCAGACAAGTTTCCCTGCCAGTTACCAAATCTACTGACAATGCATTTGAGAACCCTTTCTTTAAAGATTCTTTTGGTTCATCACAAGCCTCTGTGGCTTCTTCTCAACCTGTATCTTCTGAGATGTATAGGGATCCATTTGGAAATCCTTTTGCCTAAATTCTGAACTTGGTCTGCAGACCATCCAGAGGAATAAAAAGGTTGGCCTTAGTAGTCAAAAACAAAGCTGATAGCCAGACACGTTCTGATTTCTGCCCTTGTTCCAGCTTTGACGT

Ensembl | numer dostępu dla gatunku człowiek

numer dostępu NCBI

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Nie możesz znaleźć właściwego produktu?  

Wypróbuj nasz Narzędzie selektora produktów.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable


Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Yuan Cheng et al.
Journal of experimental & clinical cancer research : CR, 35, 11-11 (2016-01-16)
MicroRNA-106b (miR-106b) was recently identified as an oncogene participating in cancer progression. Transforming growth factor β1(TGF-β1) is an indispensable cytokine regulating the local microenvironment, thereby promoting cervical cancer progression. However, the roles of miR-106b in cervical carcinoma progression and TGF-β1-involvement
Yoshitaka Itami et al.
Diagnostics (Basel, Switzerland), 10(1) (2020-01-24)
Disabled homolog-2 (DAB2) has been reported to be a tumor suppressor gene. However, a number of contrary studies suggested that DAB2 promotes tumor invasion in urothelial carcinoma of the bladder (UCB). Here, we investigated the clinical role and biological function
Mio Nakanishi et al.
Cell, 177(4), 910-924 (2019-04-16)
The assembly of organized colonies is the earliest manifestation in the derivation or induction of pluripotency in vitro. However, the necessity and origin of this assemblance is unknown. Here, we identify human pluripotent founder cells (hPFCs) that initiate, as well as

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej