Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Kluczowe dokumenty

EHU078901

Sigma-Aldrich

MISSION® esiRNA

targeting human GPI

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych


About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

CACCAAGGCACCAAGATGATACCCTGTGACTTCCTCATCCCGGTCCAGACCCAGCACCCCATACGGAAGGGTCTGCATCACAAGATCCTCCTGGCCAACTTCTTGGCCCAGACAGAGGCCCTGATGAGGGGAAAATCGACGGAGGAGGCCCGAAAGGAGCTCCAGGCTGCGGGCAAGAGTCCAGAGGACCTTGAGAGGCTGCTGCCACATAAGGTCTTTGAAGGAAATCGCCCAACCAACTCTATTGTGTTCACCAAGCTCACACCATTCATGCTTGGAGCCTTGGTCGCCATGTATGAGCACAAGATCTTCGTTCAGGGCATCATCTGGGACATCAACAGCTTTGACCAGTGGGGAGTGGAGCTGGGAAAGCAGCTGGCTAAGAAAATAGAGCCTGAGCTTGATGGCAGTGCTCAAGTGACCTCTCACGACGCTTCTACC

Ensembl | numer dostępu dla gatunku człowiek

numer dostępu NCBI

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Nie możesz znaleźć właściwego produktu?  

Wypróbuj nasz Narzędzie selektora produktów.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable


Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Yiran Li et al.
International journal of oncology, 47(3), 1017-1024 (2015-07-24)
Autocrine motility factor (AMF) as a cytokine and a growth factor, is known to regulate tumor cell growth and motility in the progress of various human malignant tumors, however, its role in endometrial cancer (EC) has not been fully studied.
Ming Zong et al.
Arthritis research & therapy, 17, 100-100 (2015-04-19)
Fibroblast-like synoviocytes (FLS) play an important role in the pathogenesis of rheumatoid arthritis (RA). This study aimed to investigate the role of glucose 6-phosphate isomerase (GPI) in the proliferation of RA-FLS. The distribution of GPI in synovial tissues from RA
Dongling Zou et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 36(9), 6725-6732 (2015-04-03)
Chemotherapy is the preferred therapeutic approach for the therapy of advanced ovarian cancer, but 5-year survival rate remains low due to the development of drug resistance. Increasing evidence has documented that microRNAs (miRNAs) act important roles in drug resistance in
Gina Shaw-Hallgren et al.
PloS one, 9(5), e96506-e96506 (2014-05-13)
Nemo-like kinase (NLK), a proline-directed serine/threonine kinase regulated by phosphorylation, can be localized in the cytosol or in the nucleus. Whether the localization of NLK can affect cell survival or cell apoptosis is yet to be disclosed. In the present

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej