Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Kluczowe dokumenty

EHU075381

Sigma-Aldrich

MISSION® esiRNA

targeting human ADAM17

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

TGGTTGGTGAGCCTGACTCTAGGGTTCTAGCCCACATAAGAGATGATGATGTTATAATCAGAATCAACACAGATGGGGCCGAATATAACATAGAGCCACTTTGGAGATTTGTTAATGATACCAAAGACAAAAGAATGTTAGTTTATAAATCTGAAGATATCAAGAATGTTTCACGTTTGCAGTCTCCAAAAGTGTGTGGTTATTTAAAAGTGGATAATGAAGAGTTGCTCCCAAAAGGGTTAGTAGACAGAGAACCACCTGAAGAGCTTGTTCATCGAGTGAAAAGAAGAGCTGACCCAGATCCCATGAAGAACACGTGTAAATTATTGGTGGTAGCAGATCATCGCTTCTACAGATACATGGGCAGAGGGGAAGAGAGTACAACTACAAATTACTTAATAGAGCTAATTGACAGAGTTGATGACATCTATCGGAACACTTCATGGG

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000151694

numer dostępu NCBI

NM_003183

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... ADAM17(6868) , ADAM17(6868)

Powiązane kategorie

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Nie możesz znaleźć właściwego produktu?  

Wypróbuj nasz Narzędzie selektora produktów.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Junsuke Uwada et al.
Cellular signalling, 35, 188-196 (2017-04-17)
Intestinal epithelial cells form a tight barrier to act as selective physical barriers, repelling hostile substances. Tumor necrosis factor-α (TNF-α) is a well characterized pro-inflammatory cytokine which can compromise intestinal barrier function and the suppression of TNF-α function is important
Takaaki Uchibori et al.
Cytokine, 90, 88-95 (2016-11-20)
Osteopontin (OPN) is a pro-fibrotic molecule upregulated by pro-inflammatory cytokines. Interleukin (IL)-6 functions downstream of IL-1β and has unique signal pathways: classic- or trans-signaling via membrane-bound IL-6R or soluble IL-6R (sIL-6R). We investigated the effect of IL-6 trans-signaling on the
Qi Zhang et al.
Biochemical and biophysical research communications, 503(4), 2333-2339 (2018-07-03)
We investigated the role of a disintegrin and metalloproteinase 17 (ADAM17) in chemo resistance, and to clarify the mechanism underlying reverse of L-OHP resistance by knockdown of ADAM17. CRC tissues with corresponding adjacent normal tissues were collected. The mRNA and
Franziska Rademacher et al.
Experimental dermatology, 26(3), 227-233 (2016-08-12)
The ribonuclease RNase 7 is a major skin-derived human antimicrobial protein expressed in keratinocytes. Here we show that the gram-negative pathogen Pseudomonas aeruginosa secretes factor(s) that induced RNase 7 gene and protein expression in human primary keratinocytes. The metalloprotease inhibitor
Timo Effenberger et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 28(11), 4847-4856 (2014-08-01)
Cellular senescence, a state of persistent cell cycle arrest, has emerged as a potent tumor suppressor mechanism by restricting proliferation of cells at risk for neoplastic transformation. Senescent cells secrete various growth factors, cytokines, and other proteins that can either
Wyświetl wszystkie powiązane dokumenty

Protokoły

Coronavirus qPCR Design Case Study & Related Products to Support SARS-CoV-2 Research

Coronavirus qPCR Primer and probe sets for the detection of SARS-CoV-2 (Corona Virus), with additional real-time RT-PCR, RT-qPCR and supporting reagents available.

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej