Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Key Documents

EHU072971

Sigma-Aldrich

MISSION® esiRNA

targeting human MAPK8

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

AAGCTAAGCCGACCATTTCAGAATCAGACTCATGCCAAGCGGGCCTACAGAGAGCTAGTTCTTATGAAATGTGTTAATCACAAAAATATAATTGGCCTTTTGAATGTTTTCACACCACAGAAATCCCTAGAAGAATTTCAAGATGTTTACATAGTCATGGAGCTCATGGATGCAAATCTTTGCCAAGTGATTCAGATGGAGCTAGATCATGAAAGAATGTCCTACCTTCTCTATCAGATGCTGTGTGGAATCAAGCACCTTCATTCTGCTGGAATTATTCATCGGGACTTAAAGCCCAGTAATATAGTAGTAAAATCTGATTGCACTTTGAAGATTCTTGACTTCGGTCTGGCCAGGACTGCAGGAACGAGTTTTATGATGACGCCTTATGTAGTGACTCGCTACTACAGAGCACCCGAGGTCATCCTTGGCATGGGCTACAAGGAAAAC

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000107643

numer dostępu NCBI

NM_139049

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... MAPK8(5599) , MAPK8(5599)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Wen-Pin Cheng et al.
Journal of the Formosan Medical Association = Taiwan yi zhi, 116(5), 388-397 (2016-09-21)
TRB3 (tribbles 3), an apoptosis-regulated gene, increases during endoplasmic reticulum stress. Hypoxia can induce inflammatory mediators and apoptosis in cardiomyocytes. However, the expression of TRB3 in cardiomyocyte apoptosis under hypoxia is not thoroughly known. We investigated the regulation mechanism of
Lan Xu et al.
Journal of molecular endocrinology (2019-03-27)
Obesity is a worldwide health problem with rising incidence and results in reproductive difficulties. Elevated saturated free fatty acids (FFAs) in obesity can cause insulin resistance (IR) in peripheral tissues. The high intra-follicular saturated FFAs may also account for IR
Lei Zhou et al.
Oncotarget, 8(55), 94009-94019 (2017-12-08)
Isoflurane can provide both neuroprotection and neurotoxicity in various culture models and in rodent developing brains. Emulsified Isoflurane (EI) is an emulsion formulation of isoflurane, while its underlying molecular mechanism of developemental nerve toxicity largely remains unclear. We hypothesized that
Mei-Chuan Chen et al.
Scientific reports, 7, 46149-46149 (2017-04-08)
Patients with ovarian cancer are typically diagnosed at an advanced stage, resulting in poor prognosis since there are currently no effective early-detection screening tests for women at average-risk for ovarian cancer. Here, we investigated the effects of MT-6, a derivative
Xu Qin et al.
Molecular carcinogenesis, 53(7), 526-536 (2013-01-30)
The c-Jun NH2 -terminal kinase (JNK) signal pathway has been implicated in the growth, cellular proliferation, and apoptosis in many kinds of carcinomas. However, the role of JNK in the development of esophageal squamous cell carcinomas (ESCCs) is unknown. To
Wyświetl wszystkie powiązane dokumenty

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej