Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Kluczowe dokumenty

EHU070981

Sigma-Aldrich

MISSION® esiRNA

targeting human E2F1

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

Formularz

lyophilized powder

sekwencja docelowa esiRNA cDNA

ACCCCTCTCCTCTGTCTCCAGAAGCTTCTAGCTCTGGGGTCTGGCTACCGCTAGGAGGCTGAGCAAGCCAGGAAGGGAAGGAGTCTGTGTGGTGTGTATGTGCATGCAGCCTACACCCACACGTGTGTACCGGGGGTGAATGTGTGTGAGCATGTGTGTGTGCATGTACCGGGGAATGAAGGTGAACATACACCTCTGTGTGTGCACTGCAGACACGCCCCAGTGTGTCCACATGTGTGTGCATGAGTCCATGTGTGCGCGTGGGGGGGCTCTAACTGCACTTTCGGCCCTTTTGCTCTGGGGGTCCCACAAGGCCCAGGGCAGTGCCTGCTCCCAGAATCTGGTGCTCTGACCAGGCCAGGTGGGGAGGCTTTGGCTGGCTGGGCGTGTAGGACGGTGAGAGCACTTCT

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000101412

numer dostępu NCBI

NM_005225

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... E2F1(1869) , E2F1(1869)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Nie możesz znaleźć właściwego produktu?  

Wypróbuj nasz Narzędzie selektora produktów.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Wybierz jedną z najnowszych wersji:

Certyfikaty analizy (CoA)

Lot/Batch Number
WPU
LOU
XJU
BUT
HQS

Nie widzisz odpowiedniej wersji?

Jeśli potrzebujesz konkretnej wersji, możesz wyszukać konkretny certyfikat według numeru partii lub serii.

Wyszukaj dokument COA

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Yuan He et al.
Life sciences, 252, 117656-117656 (2020-04-15)
Diabetes is considered as one of the important risks in the progression of Hepatocellular carcinoma(HCC). Ribosome binding protein 1 (RRBP1), a rough endoplasmic reticulum protein, plays an essential role in diabetes and various cancer. E2F transcription factor 1 (E2F1), an
Lei Liu et al.
Oncology reports, 37(6), 3597-3605 (2017-05-13)
Tripartite motif containing 28 (TRIM28) is a universal corepressor for Kruppel‑associated box zinc finger proteins. In our previous study, it was shown that expression of TRIM28 is upregulated in non‑small cell lung cancer (NSCLC) cell lines and tissues. Here, we
Wen Luo et al.
Scientific reports, 6, 27904-27904 (2016-06-11)
miR-17 family microRNAs (miRNAs) are crucial for embryo development, however, their role in muscle development is still unclear. miR-20a-5p and miR-20b-5p belong to the miR-17 family and are transcribed from the miR-17~92 and miR-106a~363 clusters respectively. In this study, we
Juan Liu et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 37(2), 2673-2682 (2015-09-26)
Cancerous inhibitor of protein phosphatase 2A (CIP2A) is a recently identified oncoprotein. Here, we investigated its role in the formation of multidrug resistance (MDR) of cervical adenocarcinoma in vitro and in vivo. MTT assay showed that knockdown of CIP2A expression
Dan Zhao et al.
Frontiers in molecular neuroscience, 12, 281-281 (2019-12-24)
Intracerebral hemorrhage (ICH) is a subtype of stroke with highest mortality and morbidity. We have previously demonstrated that dipotassium bisperoxo (picolinato) oxovanadate (V), (bpV[pic]) inhibits phosphatase and tensin homolog (PTEN) and activates extracellular signal-regulated kinase (ERK)1/2. In this study, we
Wyświetl wszystkie powiązane dokumenty

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej