Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Kluczowe dokumenty

EHU065921

Sigma-Aldrich

MISSION® esiRNA

targeting human PRMT5

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

Formularz

lyophilized powder

sekwencja docelowa esiRNA cDNA

TGCAGTGGCTCTTGAAATTGGGGCTGACCTCCCATCTAATCATGTCATTGATCGCTGGCTTGGGGAGCCCATCAAAGCAGCCATTCTCCCCACTAGCATTTTCCTGACCAATAAGAAGGGATTTCCTGTTCTTTCTAAGATGCACCAGAGGCTCATCTTCCGGCTCCTCAAGTTGGAGGTGCAGTTCATCATCACAGGCACCAACCACCACTCAGAGAAGGAGTTCTGCTCCTACCTCCAATACCTGGAATACTTAAGCCAGAACCGTCCTCCACCTAATGCCTATGAACTCTTTGCCAAGGGCTATGAAGACTATCTGCAGTCCCCGCTTCAGCCACTGATGGACAATCTGGAATCTCAGACATATGAAGTGTTTGAAAAGGACCCCATCAAATACTCTCAGTACCAGCAGGCC

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000100462

numer dostępu NCBI

NM_006109

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... PRMT5(10419) , PRMT5(10419)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Działania biochem./fizjol.

PRMTs (protein arginine N-methyltransferases) are responsible for the methylation of arginine residues in histones. PRMT5 causes monomethylation and symmetric dimethylation reactions. It works as an oncogene is some neoplasms and is associated with cell proliferation, inhibition of cell death and regulation of tumor suppressor genes. PRMT5 is also involved in stem cell maintenance by controlling differentiation-associated genes. It is involved in cellular responses, including neurogenesis and myogenesis metabolic events, somatic cell reprogramming, regulation of Golgi apparatus, ribosome biogenesis and neuronal spreading and movements.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Nie możesz znaleźć właściwego produktu?  

Wypróbuj nasz Narzędzie selektora produktów.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Wybierz jedną z najnowszych wersji:

Certyfikaty analizy (CoA)

Lot/Batch Number
RXU
MWU
BWU
MSU
IDU

Nie widzisz odpowiedniej wersji?

Jeśli potrzebujesz konkretnej wersji, możesz wyszukać konkretny certyfikat według numeru partii lub serii.

Wyszukaj dokument COA

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Dongying Chen et al.
Journal of cellular and molecular medicine, 21(4), 781-790 (2016-11-20)
To probe the role of protein arginine methyltransferase 5 (PRMT5) in regulating inflammation, cell proliferation, migration and invasion of fibroblast-like synoviocytes (FLSs) from patients with rheumatoid arthritis (RA). FLSs were separated from synovial tissues (STs) from patients with RA and
Myc and Omomyc functionally associate with the Protein Arginine Methyltransferase 5 (PRMT5) in glioblastoma cells.
Mongiardi MP
Scientific Reports, 5, 15494-15494 (2015)
Nan Wang et al.
Cell death & disease, 11(10), 864-864 (2020-10-17)
Metastasis is the main cause of laryngeal cancer-related death; its molecular mechanism remains unknown. Here we identify protein arginine methyltransferase 5 (PRMT5) as a new metastasis-promoting factor in laryngeal carcinoma, and explore its underlying mechanism of action in regulating laryngeal
Ju-Yeon Jeon et al.
Oncology reports, 40(1), 536-544 (2018-05-12)
Protein arginine methyltransferase 5 (PRMT5) is a protein that catalyzes transfer of methyl groups to the arginine residues of proteins and is involved in diverse cellular and biological responses. While the participation of PRMT5 in cancer progression has been increasingly documented
X Deng et al.
Oncogene, 36(9), 1223-1231 (2016-08-23)
Protein arginine methyltransferase 5 (PRMT5) is an emerging epigenetic enzyme that mainly represses transcription of target genes via symmetric dimethylation of arginine residues on histones H4R3, H3R8 and H2AR3. Accumulating evidence suggests that PRMT5 may function as an oncogene to
Wyświetl wszystkie powiązane dokumenty

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej