Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Kluczowe dokumenty

EHU039481

Sigma-Aldrich

MISSION® esiRNA

targeting human CLTC

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

CCAGATCAGGGACAGCAGTTTGCCCAAATGTTAGTTCAAGATGAAGAGCCTCTTGCTGACATCACACAGATTGTAGATGTCTTTATGGAATACAATCTAATTCAGCAGTGTACTGCATTCTTGCTTGATGCTCTGAAGAATAATCGCCCATCTGAAGGTCCTTTACAGACGCGGTTACTTGAGATGAACCTTATGCATGCGCCTCAAGTTGCAGATGCTATTCTAGGCAATCAGATGTTCACACATTATGACCGGGCTCATATTGCTCAACTGTGTGAAAAGGCTGGCCTACTGCAGCGTGCATTAGAACATTTCACTGATTTATATGATATAAAACGTGCAGTGGTTCACACCCATCTTCTTAACCCTGAGTGGTTAGTCAACTACTTTGGTTCCTTATCAGTAGAAGACTCCCTAGAATGTCTCAGAGCCATGCTGTCTGCCAACATCCGTCAGAATCTGCAGA

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000141367

numer dostępu NCBI

NM_004859

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... CLTC(1213) , CLTC(1213)

Powiązane kategorie

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Nie możesz znaleźć właściwego produktu?  

Wypróbuj nasz Narzędzie selektora produktów.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Min Feng et al.
Virus research, 253, 12-19 (2018-05-29)
Bombyx mori nucleopolyhedrovirus (BmNPV) is a leading cause of silkworm mortality and economic loss to sericulture. The entry of BmNPV budded virus (BV) into host cells is a fundamental process required for the initiation of infection. However, our understanding of
Jiao Liu et al.
Science signaling, 12(585) (2019-06-13)
Transient receptor potential vanilloid 1 (TRPV1), a nonselective, ligand-gated cation channel, responds to multiple noxious stimuli and is targeted by many kinases that influence its trafficking and activity. Studies on the internalization of TRPV1 have mainly focused on that induced
Dipannita Dutta et al.
Traffic (Copenhagen, Denmark), 16(9), 994-1009 (2015-05-20)
Clathrin-mediated endocytosis (CME) and clathrin-independent endocytosis (CIE) co-exist in most cells but little is known about their communication and coordination. Here we show that when CME was inhibited, endocytosis by CIE continued but endosomal trafficking of CIE cargo proteins was
Ruobo Zhou et al.
Science (New York, N.Y.), 365(6456), 929-934 (2019-08-31)
Actin, spectrin, and related molecules form a membrane-associated periodic skeleton (MPS) in neurons. The function of the MPS, however, remains poorly understood. Using super-resolution imaging, we observed that G protein-coupled receptors (GPCRs), cell adhesion molecules (CAMs), receptor tyrosine kinases (RTKs)
Annalisa Natalicchio et al.
Diabetologia, 58(6), 1260-1271 (2015-03-27)
The role of the redox adaptor protein p66(Shc) as a potential mediator of saturated fatty acid (FA)-induced beta cell death was investigated. The effects of the FA palmitate on p66(Shc) expression were evaluated in human and murine islets and in
Wyświetl wszystkie powiązane dokumenty

Protokoły

Coronavirus qPCR Design Case Study & Related Products to Support SARS-CoV-2 Research

Coronavirus qPCR Primer and probe sets for the detection of SARS-CoV-2 (Corona Virus), with additional real-time RT-PCR, RT-qPCR and supporting reagents available.

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej