Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Kluczowe dokumenty

EHU024531

Sigma-Aldrich

MISSION® esiRNA

targeting human MAP3K14

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

ACTGAGGACAACGAGGGTGTCCTGCTCACTGAGAAACTCAAGCCAGTGGATTATGAGTACCGAGAAGAAGTCCACTGGGCCACGCACCAGCTCCGCCTGGGCAGAGGCTCCTTCGGAGAGGTGCACAGGATGGAGGACAAGCAGACTGGCTTCCAGTGCGCTGTCAAAAAGGTGCGGCTGGAAGTATTTCGGGCAGAGGAGCTGATGGCATGTGCAGGATTGACCTCACCCAGAATTGTCCCTTTGTATGGAGCTGTGAGAGAAGGGCCTTGGGTCAACATCTTCATGGAGCTGCTGGAAGGTGGCTCCCTGGGCCAGCTGGTCAAGGAGCAGGGCTGTCTCCCAGAGGACCGGGCCCTGTACTACCTGGGCCAGGCCCTGGAGGGTCTGGAATACCTCCACTCACGAAGGATTCTGCA

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000006062

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... MAP3K14(9020) , MAP3K14(9020)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Kislay Parvatiyar et al.
Nature communications, 9(1), 2770-2770 (2018-07-19)
Detection of viral genomes by the innate immune system elicits an antiviral gene program mediated by type I interferons (IFNs). While viral RNA and DNA species induce IFN via separate pathways, the mechanisms by which these pathways are differentially modulated
Miles C Duncan et al.
PloS one, 12(2), e0171406-e0171406 (2017-02-07)
Infection of human cells with Yersinia pseudotuberculosis expressing a functional type III secretion system (T3SS) leads to activation of host NF-κB. We show that the Yersinia T3SS activates distinct NF-κB pathways dependent upon bacterial subcellular localization. We found that wildtype
Paulina Kucharzewska et al.
Journal of cell science, 132(7) (2019-03-07)
NF-κB-inducing kinase (NIK; also known as MAP3K14) is a central regulator of non-canonical NF-κB signaling in response to stimulation of TNF receptor superfamily members, such as the lymphotoxin-β receptor (LTβR), and is implicated in pathological angiogenesis associated with chronic inflammation
Po Y Mak et al.
British journal of haematology, 167(3), 376-384 (2014-08-01)
Overexpression of the apoptosis repressor with caspase recruitment domain (ARC, also termed NOL3) protein predicts adverse outcome in patients with acute myeloid leukaemia (AML) and confers drug resistance to AML cells. The second mitochondrial-derived activator of caspases (SMAC, also termed
Katharina Mörs et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 43(1), 17-30 (2017-08-30)
Alcohol (ethanol, EtOH) as significant contributor to traumatic injury is linked to suppressed inflammatory response, thereby influencing clinical outcomes. Alcohol-induced immune-suppression during acute inflammation (trauma) was linked to nuclear factor-kappaB (NF-ĸB). Here, we analyzed alcohol`s effects and mechanisms underlying its
Wyświetl wszystkie powiązane dokumenty

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej