Przejdź do zawartości
Merck

EHU020611

Sigma-Aldrich

MISSION® esiRNA

targeting human MUS81

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych


About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

linia produktu

MISSION®

Formularz

lyophilized powder

sekwencja docelowa esiRNA cDNA

AGTCGGTGCGAGAAGTGTTTGCCCGGCAGCTGATGCAGGTGCGCGGAGTGAGTGGGGAGAAGGCAGCAGCCCTGGTGGATCGATACAGCACCCCTGCCAGCCTCCTGGCCGCCTATGATGCCTGTGCCACCCCCAAGGAACAAGAGACACTGCTGAGCACCATTAAGTGTGGGCGTCTACAGAGGAATCTGGGGCCTGCTCTGAGCAGGACCTTATCCCAGCTCTACTGCAGCTACGGCCCCTTGACCTGAGCTTATGCCGTGAAACAGCCCCCAGCCCCCGTCTGTCCCCCAACCCAGGCTAGCCAGCCTTTTAACAACATCTTTTGGGGTACAATTAGAATCTAAGTGTTTGCAGCCATATGTGTCATGTAGAAGATGCCTAGCCCTGGGGACCTTGTGAAATACGCAGGAACCAGGGATAC

Ensembl | numer dostępu dla gatunku człowiek

numer dostępu NCBI

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

Opis ogólny

3355 esiRNA to siRNA przygotowane z użyciem endorybonukleazy. Stanowią one heterogeniczną mieszaninę siRNA, które celują w tę samą sekwencję mRNA. Te wielokrotne wyzwalacze wyciszania prowadzą do wysoce specyficznego i skutecznego wyciszania genów.

Aby uzyskać dodatkowe informacje, a także wyświetlić wszystkie dostępne opcje esiRNA, odwiedź SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable


Wybierz jedną z najnowszych wersji:

Certyfikaty analizy (CoA)

Lot/Batch Number

Nie widzisz odpowiedniej wersji?

Jeśli potrzebujesz konkretnej wersji, możesz wyszukać konkretny certyfikat według numeru partii lub serii.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Ying Wai Chan et al.
Nature communications, 5, 4844-4844 (2014-09-12)
Holliday junction (HJ) resolvases are necessary for the processing of persistent recombination intermediates before cell division. Their actions, however, need to be restricted to the late stages of the cell cycle to avoid the inappropriate cleavage of replication intermediates. Control
Delphine Lemaçon et al.
Nature communications, 8(1), 860-860 (2017-10-19)
The breast cancer susceptibility proteins BRCA1 and BRCA2 have emerged as key stabilizing factors for the maintenance of replication fork integrity following replication stress. In their absence, stalled replication forks are extensively degraded by the MRE11 nuclease, leading to chemotherapeutic
Yuping Yin et al.
Molecular cancer therapeutics, 18(8), 1439-1450 (2019-05-31)
DNA replication and repair proteins play an important role in cancer initiation and progression by affecting genomic instability. The DNA endonuclease Mus81 is a DNA structure-specific endonuclease, which has been implicated in DNA replication and repair. In this study, we
Ying Wai Chan et al.
Nature cell biology, 20(1), 92-103 (2017-12-20)
The resolution of joint molecules that link recombining sister chromatids is essential for chromosome segregation. Here, we determine the fate of unresolved recombination intermediates arising in cells lacking two nucleases required for resolution (GEN1 -/- knockout cells depleted of MUS81).
Haiqing Fu et al.
Nature communications, 6, 6746-6746 (2015-04-17)
The Mus81 endonuclease resolves recombination intermediates and mediates cellular responses to exogenous replicative stress. Here, we show that Mus81 also regulates the rate of DNA replication during normal growth by promoting replication fork progression while reducing the frequency of replication

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej