Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Kluczowe dokumenty

Wyświetl całą dokumentację

EHU019961

Sigma-Aldrich

MISSION® esiRNA

targeting human TNFAIP3

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

ATGCGGAAAGCTGTGAAGATACGGGAGAGAACTCCAGAAGACATTTTTAAACCTACTAATGGGATCATTCATCATTTTAAAACCATGCACCGATACACACTGGAAATGTTCAGAACTTGCCAGTTTTGTCCTCAGTTTCGGGAGATCATCCACAAAGCCCTCATCGACAGAAACATCCAGGCCACCCTGGAAAGCCAGAAGAAACTCAACTGGTGTCGAGAAGTCCGGAAGCTTGTGGCGCTGAAAACGAACGGTGACGGCAATTGCCTCATGCATGCCACTTCTCAGTACATGTGGGGCGTTCAGGACACAGACTTGGTACTGAGGAAGGCGCTGTTCAGCACGCTCAAGGAAACAGACACACGCAACTTTAAATTCCGCTGGCAACTGGAGTCTCTCAAATCTCAGGAATTTGTTGAAACGGGGCTTTGCTATGATACTCGGAACTGGAATGATGAATGGGACAATCTTATCAAAATGGCTTCCACAGACACACCCATG

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000118503

numer dostępu NCBI

NM_006290

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... TNFAIP3(7128) , TNFAIP3(7128)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Nie możesz znaleźć właściwego produktu?  

Wypróbuj nasz Narzędzie selektora produktów.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Zhipeng Li et al.
Brain, behavior, and immunity, 79, 228-235 (2019-02-11)
Neuroinflammation is now recognized to be a feature of many neurological disorders. More accumulated evidences suggested chrysin which was contained in honey, propolis, vegetables, fruits and plants can exert biological activities including anti-neuroinflammatory effects. However, the precise molecular mechanisms of
Hongjun Zhao et al.
Rheumatology (Oxford, England), 56(5), 835-843 (2017-02-06)
TNF-α-induced protein 3 ( TNFAIP3 ) is one of the major SLE susceptibility genes involved in the regulation of inflammatory responses through modulation of the nuclear factor-κB (NF-κB) pathway. We aim to assess TNFAIP3 expression in CD4 + T cells
Wenjing Feng et al.
Biochemical and biophysical research communications, 482(4), 1107-1113 (2016-12-05)
The innate immune response provides the first line of defense against viruses and other pathogens by responding to specific microbial molecules. A20 is a cytoplasmic ubiquitin-editing protein that negatively regulates the retinoic acid-inducible gene I (RIG-I)-mediated activation of interferon regulatory
Meng Qin et al.
Frontiers in pharmacology, 8, 953-953 (2018-01-10)
Atherosclerosis (AS) is a chronic inflammatory disease and endothelial cell injury is the initial event. In this study, we investigated the protective effects of ginsenoside F1 (GF1) on AS and the potential molecular mechanisms of ox-LDL induced endothelial injury. ApoE-/-
Ming-Yang Li et al.
Oncotarget, 7(48), 79914-79924 (2016-11-09)
The regulatory B cells (Breg) are important in the body immunity. The differentiation process of Breg is not fully understood yet. Ubiquitin A20 has immune regulatory functions. This study aims to investigate the role of A20 in the regulation of
Wyświetl wszystkie powiązane dokumenty

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej