Przejdź do zawartości
Merck

EHU018281

Sigma-Aldrich

MISSION® esiRNA

targeting human TXNRD1

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych


About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

linia produktu

MISSION®

Formularz

lyophilized powder

sekwencja docelowa esiRNA cDNA

ACAAGCCCTGCAAGACTCTCGAAATTATGGATGGAAAGTCGAGGAGACAGTTAAGCATGATTGGGACAGAATGATAGAAGCTGTACAGAATCACATTGGCTCTTTGAATTGGGGCTACCGAGTAGCTCTGCGGGAGAAAAAAGTCGTCTATGAGAATGCTTATGGGCAATTTATTGGTCCTCACAGGATTAAGGCAACAAATAATAAAGGCAAAGAAAAAATTTATTCAGCAGAGAGATTTCTCATTGCCACTGGTGAAAGACCACGTTACTTGGGCATCCCTGGTGACAAAGAATACTGCATCAGCAGTGATGATCTTTTCTCCTTGCCTTACTGCCCGGGTAAGACCCTGGTTGTTGGAGCATCCTATGTCGCTTTGGAGTGCGCTGGATTTCTTGCTGGTATTGGTTTAGACGTCACTGTTATGGTTAGGTCCATTCTTCTTAGAGGATTTGACCAGGACATGGCCAACAAAATTGGTGAACACATGGAAGAACATGGCA

Ensembl | numer dostępu dla gatunku człowiek

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable


Wybierz jedną z najnowszych wersji:

Certyfikaty analizy (CoA)

Lot/Batch Number

Nie widzisz odpowiedniej wersji?

Jeśli potrzebujesz konkretnej wersji, możesz wyszukać konkretny certyfikat według numeru partii lub serii.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Yichong Wang et al.
Oncology reports, 37(5), 2905-2912 (2017-04-14)
Aberrant neovascularization supports nutrients and the oxygen microenvironment in tumour growth, invasion and metastasis. Recapitulation of functional microvascular structures in vitro could provide a platform for the study of vascular conditions. Sulforaphane (SFN), an isothiocyanate, has been reported to possess chemopreventive
Chuncheng Hao et al.
Oncology letters, 13(4), 2071-2078 (2017-04-30)
Radiation treatment remains one of the major modalities in the treatment of lung cancer. Although the majority of patients initially respond to treatment with radiation, resistance inevitably develops and leads to treatment failure. Therefore, the identification of the underlying molecular
Xinzhi Wang et al.
Redox biology, 24, 101153-101153 (2019-03-26)
The early immature CD34+ acute myeloid leukemia (AML) cell subpopulation-acute myeloid leukemia progenitor cells (APCs), is often resistant to conventional chemotherapy, making them largely responsible for the relapse of AML. However, to date, the eradication of APCs remains a major
Bo Ra You et al.
Molecular carcinogenesis, 53(11), 847-857 (2013-05-11)
Zebularine (Zeb) is a DNA methyltransferase (DNMT) inhibitor to that has an anti-tumor effect. Here, we evaluated the anti-growth effect of Zeb on A549 lung cancer cells in relation to reactive oxygen species (ROS) levels. Zeb inhibited the growth of

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej