Wszystkie zdjęcia(1)

Kluczowe dokumenty

Wyświetl całą dokumentację

EHU017501

MISSION^® esiRNA

Name: MISSION<SUP>®</SUP> esiRNA
Brand: SIGMA

targeting human CLDN1

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych

Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:

41105324

NACRES:

NA.51

opis

Poziom jakości

100

linia produktu

MISSION^®

Formularz

lyophilized powder

sekwencja docelowa esiRNA cDNA

GGCAGATCCAGTGCAAAGTCTTTGACTCCTTGCTGAATCTGAGCAGCACATTGCAAGCAACCCGTGCCTTGATGGTGGTTGGCATCCTCCTGGGAGTGATAGCAATCTTTGTGGCCACCGTTGGCATGAAGTGTATGAAGTGCTTGGAAGACGATGAGGTGCAGAAGATGAGGATGGCTGTCATTGGGGGTGCGATATTTCTTCTTGCAGGTCTGGCTATTTTAGTTGCCACAGCATGGTATGGCAATAGAATCGTTCAAGAATTCTATGACCCTATGACCCCAGTCAATGCCAGGTACGAATTTGGTCAGGCTCTCTTCACTGGCTGGGCTGCTGCTTCTCTCTGCCTTCTGGGAGGTGCCCTACTTTGCTGTTCCTGTCCCCGAAAAACAACCTCTTACCCAACACCAAGGCCCTATCCAAAAC

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000163347

numer dostępu NCBI

NM_021101

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... CLDN1(9076) , CLDN1(9076)

Powiązane kategorie

MISSION® esiRNA

Oligos, qPCR Probes & Peptides

Opis ogólny

MISSION^® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Ta strona może zawierać tekst przetłumaczony maszynowo.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Wybierz jedną z najnowszych wersji:

Certyfikaty analizy (CoA)

Lot/Batch Number

VKU

QCS

SAT

Nie widzisz odpowiedniej wersji?

Jeśli potrzebujesz konkretnej wersji, możesz wyszukać konkretny certyfikat według numeru partii lub serii.

Wyszukaj dokument COA

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Overexpression of microRNA-98 inhibits cell proliferation and promotes cell apoptosis via claudin-1 in human colorectal carcinoma.

Yi-Feng Zheng et al.

Journal of cellular biochemistry, 120(4), 6090-6105 (2018-12-07)

Colorectal carcinoma (CRC) is a major cause of cancer-related deaths worldwide, and investigations on novel targets are imperative. MiR-98 has been reported to act as a tumor suppressor in several cancers. To evaluate miR-98 as a novel anticancer molecule for

Methylation of the claudin 1 promoter is associated with loss of expression in estrogen receptor positive breast cancer.

Francescopaolo Di Cello et al.

PloS one, 8(7), e68630-e68630 (2013-07-12)

Downregulation of the tight junction protein claudin 1 is a frequent event in breast cancer and is associated with recurrence, metastasis, and reduced survival, suggesting a tumor suppressor role for this protein. Tumor suppressor genes are often epigenetically silenced in

MicroRNA-142-5p contributes to Hashimoto's thyroiditis by targeting CLDN1.

Jin Zhu et al.

Journal of translational medicine, 14(1), 166-166 (2016-06-10)

MicroRNAs have the potential as diagnostic biomarkers and therapeutic targets in autoimmune diseases. However, very limited studies have evaluated the expression of microRNA profile in thyroid gland related to Hashimoto's thyroiditis (HT). MicroRNA microarray expression profiling was performed and validated

Increase in Toxicity of Anticancer Drugs by PMTPV, a Claudin-1-Binding Peptide, Mediated via Down-Regulation of Claudin-1 in Human Lung Adenocarcinoma A549 Cells.

Haruka Nasako et al.

International journal of molecular sciences, 21(16) (2020-08-23)

Claudin-1 (CLDN1), a tight junctional protein, is highly expressed in lung cancer cells and may contribute to chemoresistance. A drug which decreases CLDN1 expression could be a chemosensitizer for enhancing the efficacy of anticancer drugs, but there is no such

Lentiviral Vector Mediated Claudin1 Silencing Inhibits Epithelial to Mesenchymal Transition in Breast Cancer Cells.

Xianqi Zhao et al.

Viruses, 7(6), 2965-2979 (2015-06-13)

Breast cancer has a high incidence and mortality rate worldwide. Several viral vectors including lentiviral, adenoviral and adeno-associated viral vectors have been used in gene therapy for various forms of human cancer, and have shown promising effects in controlling tumor

Global Trade Item Number

SKU	GTIN
EHU017501-20UG	4061831339857
EHU017501-50UG	4061828329762

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej