Przejdź do zawartości
Merck

EHU016451

Sigma-Aldrich

MISSION® esiRNA

targeting human PTPN1

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych


About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

TATCCGACATGAAGCCAGTGACTTCCCATGTAGAGTGGCCAAGCTTCCTAAGAACAAAAACCGAAATAGGTACAGAGACGTCAGTCCCTTTGACCATAGTCGGATTAAACTACATCAAGAAGATAATGACTATATCAACGCTAGTTTGATAAAAATGGAAGAAGCCCAAAGGAGTTACATTCTTACCCAGGGCCCTTTGCCTAACACATGCGGTCACTTTTGGGAGATGGTGTGGGAGCAGAAAAGCAGGGGTGTCGTCATGCTCAACAGAGTGATGGAGAAAGGTTCGTTAAAATGCGCACAATACTGGCCACAAAAAGAAGAAAAAGAGATGATCTTTGAAGACACAAATTTGAAATTAACATTGATCTCTGAAGATATCAAGTCATATTATACAGTGCGACAGCTAGAATTGGAAAACCTTACAACCCAAGAAACTCGAGAGATCTTACATTTCCACTATACCACATGGCCTGACTTTGGAGTCCCTGAATCACCAGCCTCATT

Ensembl | numer dostępu dla gatunku człowiek

numer dostępu NCBI

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Nie możesz znaleźć właściwego produktu?  

Wypróbuj nasz Narzędzie selektora produktów.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable


Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Akarawin Hongdusit et al.
Nature communications, 11(1), 788-788 (2020-02-09)
Protein tyrosine phosphatases regulate a myriad of essential subcellular signaling events, yet they remain difficult to study in their native biophysical context. Here we develop a minimally disruptive optical approach to control protein tyrosine phosphatase 1B (PTP1B)-an important regulator of
Caroline E Nunes-Xavier et al.
Diagnostic pathology, 14(1), 134-134 (2019-12-16)
Protein tyrosine phosphatases (PTPs) regulate neuronal differentiation and survival, but their expression patterns and functions in human neuroblastoma (NB) are scarcely known. Here, we have investigated the function and expression of the non-receptor PTPN1 on human NB cell lines and
Liza D Morales et al.
PloS one, 9(5), e97104-e97104 (2014-05-09)
To maintain tissue homeostasis, apoptosis is functionally linked to the cell cycle through the retinoblastoma (Rb)/E2F pathway. When the Rb tumor suppressor protein is functionally inactivated, E2F1 elicits an apoptotic response through both intrinsic (caspase-9 mediated) and extrinsic (caspase-8 mediated)
Samuel Legeay et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 127, 110200-110200 (2020-05-18)
Diabetes notably increases the risk for endothelial dysfunction, a main precursor for microvascular complications. While endoplasmic reticulum stress (ERS) and protein tyrosine phosphatase 1B (PTP1B) have been associated with endothelial dysfunction in resistance vessels, whether these mechanisms also contribute to
Xiaoyan Zhang et al.
Scientific reports, 5, 12987-12987 (2015-08-12)
Renal mesangial cells (RMCs) constitute a population of cells in glomerular mesangium. Inflammatory cytokines produced by RMCs play a vital role in renal inflammation. miRNAs are key regulators of inflammatory cytokine expression. The abnormal expression of renal miRNAs and the

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej