Przejdź do zawartości
Merck

EHU007101

Sigma-Aldrich

MISSION® esiRNA

targeting human CD19

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych


About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

linia produktu

MISSION®

Formularz

lyophilized powder

sekwencja docelowa esiRNA cDNA

TGGGTCCTGAGGATGAAGACTCCTTCTCCAACGCTGAGTCTTATGAGAACGAGGATGAAGAGCTGACCCAGCCGGTCGCCAGGACAATGGACTTCCTGAGCCCTCATGGGTCAGCCTGGGACCCCAGCCGGGAAGCAACCTCCCTGGGGTCCCAGTCCTATGAGGATATGAGAGGAATCCTGTATGCAGCCCCCCAGCTCCGCTCCATTCGGGGCCAGCCTGGACCCAATCATGAGGAAGATGCAGACTCTTATGAGAACATGGATAATCCCGATGGGCCAGACCCAGCCTGGGGAGGAGGGGGCCGCATGGGCACCTGGAGCACCAGGTGATCCTCAGGTGGCCAGCCTGGATCTCCTCAAGTCCCCAAGATTCACACCTGACTCTGAAATCTGAAGACCTCGAGCAGATGATGCCAACCTCTGGAGCAATGTT

Ensembl | numer dostępu dla gatunku człowiek

numer dostępu NCBI

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable


Wybierz jedną z najnowszych wersji:

Certyfikaty analizy (CoA)

Lot/Batch Number

Nie widzisz odpowiedniej wersji?

Jeśli potrzebujesz konkretnej wersji, możesz wyszukać konkretny certyfikat według numeru partii lub serii.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Feng Yan et al.
Experimental neurology, 297, 92-100 (2017-08-02)
Neuronal apoptosis is a central pathological process in subarachnoid hemorrhage (SAH)-induced early brain injury. Previous studies indicated that ErbB4 (EGFR family member v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 4) is essential for normal development and maintenance of the nervous
Sheng-Dan Nie et al.
Neurobiology of aging, 67, 171-180 (2018-04-21)
High glucose (HG)-induced mammalian target of rapamycin (mTOR) overactivation acts as a signaling hub for the formation of tau hyperphosphorylation, which contributes to the development of diabetes-associated cognitive deficit. How HG induces the sustained activation of mTOR in neurons is
Areumnuri Kim et al.
Oncotarget, 6(35), 38225-38238 (2015-10-31)
Although proteasome inhibition with bortezomib (BTZ) is a validated treatment for relapsed or refractory mantle cell lymphoma (MCL), many patients show resistance to BTZ. However, the molecular mechanism of BTZ resistance in MCL has not been elucidated. In the present
Tai Kiuchi et al.
Science signaling, 7(339), ra78-ra78 (2014-08-21)
The epidermal growth factor receptor (EGFR) is a member of the ErbB family that can promote the migration and proliferation of breast cancer cells. Therapies that target EGFR can promote the dimerization of EGFR with other ErbB receptors, which is

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej