Przejdź do zawartości
Merck

EHU007001

Sigma-Aldrich

MISSION® esiRNA

targeting human DSP

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych


About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

linia produktu

MISSION®

Formularz

lyophilized powder

sekwencja docelowa esiRNA cDNA

AGAAGTCGTTGTTGGCCACTATGAAGACAGAACTACAGAAAGCCCAGCAGATCCACTCTCAGACTTCACAGCAGTATCCACTTTATGATCTGGACTTGGGCAAGTTCGGTGAAAAAGTCACACAGCTGACAGACCGCTGGCAAAGGATAGATAAACAGATCGACTTTAGGTTATGGGACCTGGAGAAACAAATCAAGCAATTGAGGAATTATCGTGATAACTATCAGGCTTTCTGCAAGTGGCTCTATGATGCTAAACGCCGCCAGGATTCCTTAGAATCCATGAAATTTGGAGATTCCAACACAGTCATGCGGTTTTTGAATGAGCAGAAGAACTTGCACAGTGAAATATCTGGCAAACGAGACAAATCAGAGGAAGTACAAAAAATTGCTGAACTTTGCGCCAATTCAATTAAGGATTATGAGCTCCAGCTGGC

Ensembl | numer dostępu dla gatunku człowiek

numer dostępu NCBI

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable


Wybierz jedną z najnowszych wersji:

Certyfikaty analizy (CoA)

Lot/Batch Number

Nie widzisz odpowiedniej wersji?

Jeśli potrzebujesz konkretnej wersji, możesz wyszukać konkretny certyfikat według numeru partii lub serii.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Haiyong Wang et al.
Aging, 11(17), 6657-6673 (2019-09-05)
Long non-coding RNAs (lncRNAs) have been implicated in the pathogenesis of gastric cancer; however, their mechanisms of action remain largely unknown. The aim of this study was to identify lncRNAs involved in the tumorigenesis of gastric cancer and to investigate
Peipei Li et al.
International journal of biological sciences, 15(11), 2350-2362 (2019-10-09)
The interaction between genomic DNA and protein fundamentally determines the activity and the function of DNA elements. Capturing the protein complex and identifying the proteins associated with a specific DNA locus is difficult. Herein, we employed CRISPR, the well-known gene-targeting
Aritro Nath et al.
Molecular cancer research : MCR, 19(2), 240-248 (2020-10-28)
Elevated uptake of saturated fatty acid palmitate is associated with metastatic progression of cancer cells; however, the precise signaling mechanism behind the phenomenon is unclear. The loss of cell adhesion proteins, such as desmoplakin (DSP), is a key driving event
Dipal M Patel et al.
The Journal of cell biology, 206(6), 779-797 (2014-09-17)
Mechanisms by which microtubule plus ends interact with regions of cell-cell contact during tissue development and morphogenesis are not fully understood. We characterize a previously unreported interaction between the microtubule binding protein end-binding 1 (EB1) and the desmosomal protein desmoplakin
Johan Sternemalm et al.
PloS one, 10(8), e0134789-e0134789 (2015-08-05)
Deleterious mutations of the Centrosome/Spindle Pole associated Protein 1 gene, CSPP1, are causative for Joubert-syndrome and Joubert-related developmental disorders. These disorders are defined by a characteristic mal-development of the brain, but frequently involve renal and hepatic cyst formation. CSPP-L, the

Global Trade Item Number

SKUGTIN
EHU007001-50UG4061828453719
EHU007001-20UG4061828677818

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej