콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EMU009911

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Mcts1

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

CCGATGCCATGAACACATAGAAATCCTTACAGTAAATGGAGAATTACTGTTTTTTAGACAAAGAGAAGGGCCTTTTTATCCAACTTTAAGATTACTTCATAAATATCCTTTTATCTTGCCACATCAGCAGGTTGATAAAGGAGCCATCAAATTTGTACTCAGTGGAGCAAATATCATGTGTCCTGGCTTAACTTCTCCCGGAGCTAAGCTTTATCCTGCTGCAGTAGATACTATTGTTGCAATCATGGCAGAAGGAAAACAACATGCTTTATGTGTGGGTGTCATGAAGATGTCTGCAGAAGATATTGAGAAAGTAAACAAAGGAATTGGCATTGAAAATATCCATTATCTAAATGATGGTCTGTGGCATATGAAGACATATAAATGAGCCTCAAAAGGAATGTGCATGGGCTAACT

Ensembl | 마우스 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our 문서 section.

도움이 필요하시면 연락하세요. 고객 지원 부서

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

C J De Saedeleer et al.
Oncogene, 33(31), 4060-4068 (2013-10-30)
The glycolytic end-product lactate is a pleiotropic tumor growth-promoting factor. Its activities primarily depend on its uptake, a process facilitated by the lactate-proton symporter monocarboxylate transporter 1 (MCT1). Therefore, targeting the transporter or its chaperon protein CD147/basigin, itself involved in
Chunxiao Yan et al.
International journal of clinical and experimental pathology, 8(3), 2710-2718 (2015-06-06)
This study was designed to investigate the role of MCT1 in the development of cisplatin-resistant ovarian cancer and its possible relationship with Fas. We found the expression of MCT1 was obviously increased both in cisplatin-resistant ovarian cancer tissue and A2780/CP

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.