추천 제품
설명
Powered by Eupheria Biotech
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
CCGATGCCATGAACACATAGAAATCCTTACAGTAAATGGAGAATTACTGTTTTTTAGACAAAGAGAAGGGCCTTTTTATCCAACTTTAAGATTACTTCATAAATATCCTTTTATCTTGCCACATCAGCAGGTTGATAAAGGAGCCATCAAATTTGTACTCAGTGGAGCAAATATCATGTGTCCTGGCTTAACTTCTCCCGGAGCTAAGCTTTATCCTGCTGCAGTAGATACTATTGTTGCAATCATGGCAGAAGGAAAACAACATGCTTTATGTGTGGGTGTCATGAAGATGTCTGCAGAAGATATTGAGAAAGTAAACAAAGGAATTGGCATTGAAAATATCCATTATCTAAATGATGGTCTGTGGCATATGAAGACATATAAATGAGCCTCAAAAGGAATGTGCATGGGCTAACT
Ensembl | 마우스 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
mouse ... MCTS1(68995) , Mcts1(68995)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
C J De Saedeleer et al.
Oncogene, 33(31), 4060-4068 (2013-10-30)
The glycolytic end-product lactate is a pleiotropic tumor growth-promoting factor. Its activities primarily depend on its uptake, a process facilitated by the lactate-proton symporter monocarboxylate transporter 1 (MCT1). Therefore, targeting the transporter or its chaperon protein CD147/basigin, itself involved in
Chunxiao Yan et al.
International journal of clinical and experimental pathology, 8(3), 2710-2718 (2015-06-06)
This study was designed to investigate the role of MCT1 in the development of cisplatin-resistant ovarian cancer and its possible relationship with Fas. We found the expression of MCT1 was obviously increased both in cisplatin-resistant ovarian cancer tissue and A2780/CP
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.