추천 제품
설명
Powered by Eupheria Biotech
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
ACCAAGAAGGAGGGTGACCTGATAGCTGCTCAGGCTCGGCTGAAGGACCTGGAGGCTCTGCTGAACTCCAAGGAGGCCGCACTGAGCACTGCTCTCAGTGAGAAGCGCACGCTGGAGGGCGAGCTGCATGATCTGCGGGGCCAGGTGGCCAAGCTTGAGGCAGCCCTAGGTGAGGCCAAGAAGCAACTTCAGGATGAGATGCTGCGGCGGGTGGATGCTGAGAACAGGCTGCAGACCATGAAGGAGGAACTGGACTTCCAGAAGAACATCTACAGTGAGGAGCTGCGTGAGACCAAGCGCCGTCATGAGACCCGACTGGTGGAGATTGACAATGGGAAGCAGCGTGAGTTTGAGAGCCGGCTGGCGGATGCGCTGCAGGAACTGCGGGCCCAGCATGAGGACCAGGTGGAGCAGTA
Ensembl | 인체 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... LMNA(4000) , LMNA(4000)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
SIRT7 mediates L1 elements transcriptional repression and their association with the nuclear lamina.
Berta N Vazquez et al.
Nucleic acids research, 47(15), 7870-7885 (2019-06-22)
Long interspersed elements-1 (LINE-1, L1) are retrotransposons that hold the capacity of self-propagation in the genome with potential mutagenic outcomes. How somatic cells restrict L1 activity and how this process becomes dysfunctional during aging and in cancer cells is poorly
Paraskevi Sakellariou et al.
Skeletal muscle, 6, 4-4 (2016-03-01)
Studies of the pathogenic mechanisms underlying human myopathies and muscular dystrophies often require animal models, but models of some human diseases are not yet available. Methods to promote the engraftment and development of myogenic cells from individuals with such diseases
Qiao Zhang et al.
Molecular biology of the cell, 30(7), 899-906 (2018-12-20)
Cancer cell migration through narrow constrictions generates compressive stresses on the nucleus that deform it and cause rupture of nuclear membranes. Nuclear membrane rupture allows uncontrolled exchange between nuclear and cytoplasmic contents. Local tensile stresses can also cause nuclear deformations
Camilla Evangelisti et al.
Cells, 9(3) (2020-04-03)
A type lamins are fundamental components of the nuclear lamina. Changes in lamin A expression correlate with malignant transformation in several cancers. However, the role of lamin A has not been explored in osteosarcoma (OS). Here, we wanted to investigate
Mariana Reis-Sobreiro et al.
Cancer research, 78(21), 6086-6097 (2018-08-30)
Abnormalities in nuclear shape are a well-known feature of cancer, but their contribution to malignant progression remains poorly understood. Here, we show that depletion of the cytoskeletal regulator, Diaphanous-related formin 3 (DIAPH3), or the nuclear membrane-associated proteins, lamin A/C, in
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.