콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU063791

Sigma-Aldrich

MISSION® esiRNA

targeting human LMNA

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

ACCAAGAAGGAGGGTGACCTGATAGCTGCTCAGGCTCGGCTGAAGGACCTGGAGGCTCTGCTGAACTCCAAGGAGGCCGCACTGAGCACTGCTCTCAGTGAGAAGCGCACGCTGGAGGGCGAGCTGCATGATCTGCGGGGCCAGGTGGCCAAGCTTGAGGCAGCCCTAGGTGAGGCCAAGAAGCAACTTCAGGATGAGATGCTGCGGCGGGTGGATGCTGAGAACAGGCTGCAGACCATGAAGGAGGAACTGGACTTCCAGAAGAACATCTACAGTGAGGAGCTGCGTGAGACCAAGCGCCGTCATGAGACCCGACTGGTGGAGATTGACAATGGGAAGCAGCGTGAGTTTGAGAGCCGGCTGGCGGATGCGCTGCAGGAACTGCGGGCCCAGCATGAGGACCAGGTGGAGCAGTA

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Berta N Vazquez et al.
Nucleic acids research, 47(15), 7870-7885 (2019-06-22)
Long interspersed elements-1 (LINE-1, L1) are retrotransposons that hold the capacity of self-propagation in the genome with potential mutagenic outcomes. How somatic cells restrict L1 activity and how this process becomes dysfunctional during aging and in cancer cells is poorly
Paraskevi Sakellariou et al.
Skeletal muscle, 6, 4-4 (2016-03-01)
Studies of the pathogenic mechanisms underlying human myopathies and muscular dystrophies often require animal models, but models of some human diseases are not yet available. Methods to promote the engraftment and development of myogenic cells from individuals with such diseases
Qiao Zhang et al.
Molecular biology of the cell, 30(7), 899-906 (2018-12-20)
Cancer cell migration through narrow constrictions generates compressive stresses on the nucleus that deform it and cause rupture of nuclear membranes. Nuclear membrane rupture allows uncontrolled exchange between nuclear and cytoplasmic contents. Local tensile stresses can also cause nuclear deformations
Camilla Evangelisti et al.
Cells, 9(3) (2020-04-03)
A type lamins are fundamental components of the nuclear lamina. Changes in lamin A expression correlate with malignant transformation in several cancers. However, the role of lamin A has not been explored in osteosarcoma (OS). Here, we wanted to investigate
Mariana Reis-Sobreiro et al.
Cancer research, 78(21), 6086-6097 (2018-08-30)
Abnormalities in nuclear shape are a well-known feature of cancer, but their contribution to malignant progression remains poorly understood. Here, we show that depletion of the cytoskeletal regulator, Diaphanous-related formin 3 (DIAPH3), or the nuclear membrane-associated proteins, lamin A/C, in

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.